Nedd8 (NM_008683) Mouse Untagged Clone

CAT#: MC200238

Nedd8 (untagged) - Mouse neural precursor cell expressed, developmentally down-regulated gene 8 (Nedd8), (10ug)



  "NM_008683" in other vectors (4)

CNY 1200.00

CNY 2000.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Rub1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC004625 sequence for NM_008683
TGGGAAGCGGCAGCGGCAGCAGCGACCACAGCGGGAGAAGCAGCACTCTAGCCGCCTGCAACCCCAACCT GGGAAGAAGATGCTAATTAAAGTGAAGACGCTGACTGGGAAGGAGATTGAGATAGACATCGAACCCACAG ACAAGGTGGAGCGAATCAAGGAGCGTGTGGAAGAAAAAGAAGGGATTCCCCCCCAGCAGCAGCGGCTCAT CTACAGTGGCAAGCAAATGAATGATGAGAAGACAGCAGCTGATTACAAGATTCTAGGTGGTTCCGTCCTC CACCTGGTGTTGGCTCTTAGAGGAGGAGGTGGTCTTGGGCAGTGAAGAAACTTGGTTCCGTTTACCTCCT TGCCCTGCCAATCATAATGTGGCATCACATATCCTCTCACTCTCTGGGACACCAGAGCCACTGCCCCCTC TCTTGGATGCCCAATCTTGTGTGTCTACTGGTGGGAGAATGTGAGGACCCCAGGGTGCAGTGTTCCTGGC CCAGATGGCCCCTGCTGGCTATTGGGTTTTAGTTTGCAGTCATGTGTGCTTCCCTGTCTTATGGCTGTAT CCTTGGTTATCAATAAAATATTTCCTGGCCAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008683
Insert Size 246 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC004625, AAH04625
RefSeq Size 606 bp
RefSeq ORF 246 bp
Locus ID 18002
UniProt ID P29595
Gene Summary Ubiquitin-like protein which plays an important role in cell cycle control and embryogenesis. Covalent attachment to its substrates requires prior activation by the E1 complex UBE1C-APPBP1 and linkage to the E2 enzyme UBE2M. Attachment of NEDD8 to cullins activates their associated E3 ubiquitin ligase activity, and thus promotes polyubiquitination and proteasomal degradation of cyclins and other regulatory proteins.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...