Nedd8 (NM_008683) Mouse Untagged Clone
CAT#: MC200238
Nedd8 (untagged) - Mouse neural precursor cell expressed, developmentally down-regulated gene 8 (Nedd8), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Rub1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC004625 sequence for NM_008683
TGGGAAGCGGCAGCGGCAGCAGCGACCACAGCGGGAGAAGCAGCACTCTAGCCGCCTGCAACCCCAACCT GGGAAGAAGATGCTAATTAAAGTGAAGACGCTGACTGGGAAGGAGATTGAGATAGACATCGAACCCACAG ACAAGGTGGAGCGAATCAAGGAGCGTGTGGAAGAAAAAGAAGGGATTCCCCCCCAGCAGCAGCGGCTCAT CTACAGTGGCAAGCAAATGAATGATGAGAAGACAGCAGCTGATTACAAGATTCTAGGTGGTTCCGTCCTC CACCTGGTGTTGGCTCTTAGAGGAGGAGGTGGTCTTGGGCAGTGAAGAAACTTGGTTCCGTTTACCTCCT TGCCCTGCCAATCATAATGTGGCATCACATATCCTCTCACTCTCTGGGACACCAGAGCCACTGCCCCCTC TCTTGGATGCCCAATCTTGTGTGTCTACTGGTGGGAGAATGTGAGGACCCCAGGGTGCAGTGTTCCTGGC CCAGATGGCCCCTGCTGGCTATTGGGTTTTAGTTTGCAGTCATGTGTGCTTCCCTGTCTTATGGCTGTAT CCTTGGTTATCAATAAAATATTTCCTGGCCAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_008683 |
Insert Size | 246 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC004625, AAH04625 |
RefSeq Size | 606 bp |
RefSeq ORF | 246 bp |
Locus ID | 18002 |
UniProt ID | P29595 |
Gene Summary | Ubiquitin-like protein which plays an important role in cell cycle control and embryogenesis. Covalent attachment to its substrates requires prior activation by the E1 complex UBE1C-APPBP1 and linkage to the E2 enzyme UBE2M. Attachment of NEDD8 to cullins activates their associated E3 ubiquitin ligase activity, and thus promotes polyubiquitination and proteasomal degradation of cyclins and other regulatory proteins.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200148 | Nedd8 (tGFP-tagged) - Mouse neural precursor cell expressed, developmentally down-regulated gene 8 (Nedd8) |
CNY 2850.00 |
|
MR200148 | Nedd8 (Myc-DDK-tagged) - Mouse neural precursor cell expressed, developmentally down-regulated gene 8 (Nedd8) |
CNY 1200.00 |
|
MR200148L3 | Lenti ORF clone of Nedd8 (Myc-DDK-tagged) - Mouse neural precursor cell expressed, developmentally down-regulated gene 8 (Nedd8) |
CNY 4750.00 |
|
MR200148L4 | Lenti ORF clone of Nedd8 (mGFP-tagged) - Mouse neural precursor cell expressed, developmentally down-regulated gene 8 (Nedd8) |
CNY 4750.00 |