1500015O10Rik (NM_024283) Mouse Untagged Clone
CAT＃: MC200116
1500015O10Rik (untagged) - Mouse RIKEN cDNA 1500015O10 gene (1500015O10Rik), (10ug)
CNY 1200.00
CNY 2000.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Ecrg4 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002254 sequence for NM_024283
CCCACGCGTCCGCGGACGCGTGGGTTGCAGCAGACCCGCAGGGCAGTGTGCCTCGGTGGCATTGAACTGA AGCTTGGCTCTCGGCCTGGCCTGCTGGCTAGTTGCCCACCCTGTGGGTCCCGCCCAGAGCAAGGATACTG GAGCTTTCGCCTGCCTCCCTGAGCCTGGGTCTCCACTCCAGTCATCCCTCCAGCTACTTTGCAGCACTCT GTCGCCATGAGCACCTCGTCTGCGCGGCCTGCAGTCCTGGCCCTTGCCGGGCTGGCTCTGCTCCTTCTGC TGTGCCTGGGTCCAGATGGCATAAGTGGAAACAAACTCAAGAAGATGCTCCAGAAACGAGAAGGACCTGT CCCGTCAAAGACTAATGTAGCTGTAGCCGAGAACACAGCAAAGGAATTCCTAGGTGGCCTGAAGCGTGCC AAACGACAGCTGTGGGACCGTACGCGGCCTGAGGTACAGCAGTGGTACCAGCAGTTCCTCTACATGGGCT TTGATGAGGCTAAATTTGAAGATGATGTCAACTATTGGCTAAACAGAAATCGAAACGGCCATGACTACTA TGGTGACTACTACCAGCGTCATTATGATGAAGATGCGGCCATTGGTCCCCACAGCCGGGAAAGCTTCAGG CATGGAGCCAGTGTCAACTATGATGACTATTAAGCTTCCTGAGGTGCCCACAGAGCTTGTGCCTGCTTCA GTAGGCCTTCTCTACCTATACCACGTGACCATCAGGCTAAAGGAAAGAATATAAGTGCTTTTTGCATTTC ATGCATGTGCTTAACGATATGTCTCACTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_024283 |
| Insert Size | 447 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002254, AAH02254 |
| RefSeq Size | 867 bp |
| RefSeq ORF | 447 bp |
| Locus ID | 78896 |
| UniProt ID | Q99LS0 |
| Gene Summary | Probable hormone that may attenuate cell proliferation and induce senescence of oligodendrocyte and neural precursor cells in the central nervous system (PubMed:20404145). ECRG4-induced senescence is characterized by G1 arrest, RB1 dephosphorylation and accelerated CCND1 and CCND3 proteasomal degradation (PubMed:20404145).[UniProtKB/Swiss-Prot Function] |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
The Candidate Tumor Suppressor Gene Ecrg4 as a Wound Terminating Factor in Cutaneous Injury
,null,
Archives of dermatological research
,PubMed ID 22899245
[1500015O10Rik]
|
|
Ecrg4 expression and its product augurin in the choroid plexus: impact on fetal brain development, cerebrospinal fluid homeostasis and neuroprogenitor cell response to CNS injury
,null,
Fluids and Barriers of the CNS
,PubMed ID 21349154
[1500015O10Rik]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201031 | 1500015O10Rik (tGFP-tagged) - Mouse RIKEN cDNA 1500015O10 gene (1500015O10Rik) |
CNY 2850.00 |
|
| MR201031 | 1500015O10Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1500015O10 gene (1500015O10Rik) |
CNY 1200.00 |
|
| MR201031L3 | Lenti ORF clone of 1500015O10Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1500015O10 gene (1500015O10Rik) |
CNY 4750.00 |
|
| MR201031L4 | Lenti ORF clone of 1500015O10Rik (mGFP-tagged) - Mouse RIKEN cDNA 1500015O10 gene (1500015O10Rik) |
CNY 3600.00 |
其它1500015O10Rik产品
