Tex264 (NM_011573) Mouse Untagged Clone
CAT#: MC200096
Tex264 (untagged) - Mouse testis expressed gene 264 (Tex264), transcript variant 1, (10ug)
CNY 2400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | TEG-264 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002248 sequence for NM_011573
CCCACGCGTCCGCCCACGCGTCCGCCCACGCGTCCGGGGAGGCGGTCCTGACCTCTCGGCGCGGATCCTG CCTCGGTGCTGGCGCCGGAGTACTGGAGCCCTGCTGGACTGGATGCTATGAGTTGCTAAAAGTGAGCCTG ACTTTTTCGCTGCCTTGGGGTGCTGAGAGGGAGTCCCAGAAAGAACCATGCCGGATCTCCTACTACTGGG CCTGATTGGGGCCCTGACGCTGCTGTTGCTGCTGACGCTGCTGGCCTTTGCTGGTTATTCAGGACTGCTG ACTGGGGTGACAGTGAGCGCTGGATCACCCCCAATCCGCAACATAACTGTGGCCTACAAGTTCCACGTGG GGTCCTATGGTGACACTGGGCACCTTTTCACAGAGAGCTGCAGCATCTCTCCCAAGCTCCGTTCCATCGC TGTCTACTATGACAACCCCCATACGGTGCCTCCTGAGAAGTGCCGCTGTGCAGTCGGCAGCATCCTGAGT GAGGGGGAGGAGTCGCCTTCACCTGAGCTCATCCACCTCTATCAGAAATTTGGCTTCAAGATATTCTCCT TCCCAGCACCTAGCCATGTGGTCATAGCTACCTTCCCTTACACCACCCCCATATCCATCTGGCTGGCTGC CCGCCGAGTCCATCCTGCCTTGGATACCTACATCAAGGAGCGGAAGCTGTGTGCTCACCCTCGCCTGGAG ATCTACCAGCAAGACAAGATCCATTTCATGTGCCCACTGGCAAGGCAAGGAGATTTCTACGTGCCAGAGG TGAAGGAGACAGAGCGGAAATGCCGGGAGCTTGCGGAGGCCACTGACACCCAGACGGATGGCACAGGAGC TGATACAAGTGATGCAAGTTCTGTGAGCCTGGATGTTCGCCCTGGCAGCCGGGAGACTTCAGCCACCACA CTTTCTCCTGGGGCAGGCAACCGTGGCTGGGACGACGGTGACAACCGCAGCGAGCACAGCTACAGTGAAT CGGGTGCCAGTGGCTCGTCCTTTGAGGAGCTGGACCTGGAGGGCGAGGGACCCTTGGGAGAACCCCGACT GAACCCTGAAGCCAAGCTTCTGGGGCCCCCTCGGGAGCTCAGCACCCCTGAGAGGGGTGAGGAGTAATGA TAAGCCCTCAACCCTCCTGTGGTGCATTTGCTAAGGAACTGAGCAAACTCTCTAGCCCTCTTCTTCCTTA ACCTGCCTAGCTTGGGCTGGGAGTACCAGGAGCCTGAGTTGTCCTGCTCCAAGCCTAAACCTCCTTCCTC ACTGCCCTTTTGGCTCCCAGGGCCGAAGGAGCCAGAGACTGTTATCTGCACCAGCCTCCTGGGCTGCCAA CTTTGCAGACTCTTATTGGAGCTTCCAGAACCCAGAATAAAGTGAATTACTTTCTTGTTTCACCTGGAAA AAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011573 |
Insert Size | 930 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002248, AAH02248 |
RefSeq Size | 1423 bp |
RefSeq ORF | 930 bp |
Locus ID | 21767 |
UniProt ID | E9Q137 |
Gene Summary | Major reticulophagy (also called ER-phagy) receptor that acts independently of other candidate reticulophagy receptors to remodel subdomains of the endoplasmic reticulum into autophagosomes upon nutrient stress, which then fuse with lysosomes for endoplasmic reticulum turnover. The ATG8-containing isolation membrane (IM) cradles a tubular segment of TEX264-positive ER near a three-way junction, allowing the formation of a synapse of 2 juxtaposed membranes with trans interaction between the TEX264 and ATG8 proteins. Expansion of the IM would extend the capture of ER, possibly through a 'zipper-like' process involving continued trans TEX264-ATG8 interactions, until poorly understood mechanisms lead to the fission of relevant membranes and, ultimately, autophagosomal membrane closure. Also involved in the repair of covalent DNA-protein cross-links (DPCs) during DNA synthesis: acts by bridging VCP/p97 to covalent DNA-protein cross-links (DPCs) and initiating resolution of DPCs by SPRTN.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG204389 | Tex264 (tGFP-tagged) - Mouse testis expressed gene 264 (Tex264), transcript variant 1 |
CNY 2850.00 |
|
MR204389 | Tex264 (Myc-DDK-tagged) - Mouse testis expressed gene 264 (Tex264), transcript variant 1 |
CNY 2400.00 |
|
MR204389L3 | Lenti ORF clone of Tex264 (Myc-DDK-tagged) - Mouse testis expressed gene 264 (Tex264), transcript variant 1 |
CNY 4750.00 |
|
MR204389L4 | Lenti ORF clone of Tex264 (mGFP-tagged) - Mouse testis expressed gene 264 (Tex264), transcript variant 1 |
CNY 4750.00 |