Csn1s2b (NM_009973) Mouse Untagged Clone
CAT#: MC200071
Csn1s2b (untagged) - Mouse casein alpha s2-like B (Csn1s2b), (10ug)
CNY 1200.00
CNY 2000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AW987150; Cs; Csnd; Csne |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002084 sequence for NM_009973
AGCTTGTCTTCAACTTAGGAAGCAAGGACTCATTAATCATGAAGTTCATCATTCTTACTTGCCTTTTGGC CGTTGCTCTTGCAAAGCAGAGGATGGAGCAATACATCTCCAGTGAGGAGTCCATGGATAACTCTCAAGAA AACTTTAAGCAGAATATGGATGTGGCCTTTTTTCCCAGTCAGGAAACTGTAGAGAACATTTACATTCCCC AAATGGAATCTGTTGAAGCTCCCATGAAGGTATCTGACATCATTTCTCAGCAACAATACAACCAGAAAAT GATGGACATGAGTGTGAGTGCCAGAGAGAAAACTGTGATGACTGAAGAAAGTAAGAACATCCAAGACTAC ATGAACAAAATGAAACGATACAGCAAGATCACCTGGCCACAGTTTGTAAAGCTTCTCCATCAATACCAGA AAACCATGACCCCGTGGAGCTATTACCCATCTACCCCCAGCCAGGTTTGAGTGGAAAATCCACATCTCCA TTTTCTTTTCTGCTGTAATTACTTCTCATTACCAACATATTGGGATAGATGTATAAATGATACAGAAGTG GTAAACCAACAGAATGCTCCAAAATAGTTCCAGAGTATCTTCTAGTCTTGTACATTTCCATTGAATGTGT TAGGTCTGCTTGTGGGTTTCATCTCTGCAGGGTTGATGACTATTGAGACTGTCTTCACTTCTGCTCCCAT GTCACTGAACCACATTCTTTTCAAAAAATAAAACTTCAAGTGCAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009973 |
Insert Size | 432 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002084, AAH02084 |
RefSeq Size | 760 bp |
RefSeq ORF | 432 bp |
Locus ID | 12992 |
UniProt ID | P02664 |
Gene Summary | This gene is a member of the alpha-s2-like casein gene family, and this gene product is a calcium-sensitive casein. Members of this gene family are organized as a gene cluster that is conserved in its order, but with greater conservation amongst orthologs than paralogs. The protein encoded by this gene interacts with other casein proteins to form a micelle structure, and is a major source of protein in milk. This structure is important for the transport of calcium, phosphate, and protein. Alternative splicing results in multiple transcript variants encoding different protein isoforms. [provided by RefSeq, Aug 2014] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200935 | Csn1s2b (tGFP-tagged) - Mouse casein alpha s2-like B (Csn1s2b) |
CNY 2850.00 |
|
MR200935 | Csn1s2b (Myc-DDK-tagged) - Mouse casein alpha s2-like B (Csn1s2b) |
CNY 1200.00 |
|
MR200935L3 | Lenti ORF clone of Csn1s2b (Myc-DDK-tagged) - Mouse casein alpha s2-like B (Csn1s2b) |
CNY 4750.00 |
|
MR200935L4 | Lenti ORF clone of Csn1s2b (mGFP-tagged) - Mouse casein alpha s2-like B (Csn1s2b) |
CNY 4750.00 |
其它Csn1s2b产品