Arhgdig (NM_008113) Mouse Untagged Clone

CAT#: MC200058

Arhgdig (untagged) - Mouse Rho GDP dissociation inhibitor (GDI) gamma (Arhgdig), (10ug)



  "NM_008113" in other vectors (3)

CNY 2400.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Gdi5; Rho-GDI-3; Rho-GDI2; RIP2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002032 sequence for NM_008113
CGGACGCGTGGGCGACCGGGTTCCGGCGCGGTGCGGACGAAACGCGCGTCTCTGCGGGCTGCGCGGGGTC CGCGGAGCGGCTGGGGGCGCGCGGCGCGGGCGCGGCGCTGGGCGCGGGGGGCGCTCCCGGCCGGGATGAG CTCACCGCAGTCGCGCCGGGGCTGAGCCGAGCGGGCGGCGGCTCCGCGGCGGGCCGCGGCTACCATGCTG GGCCTGGACGCGTGTGAGCTGGGGGAGCAGCTGTTGGAGCTGCTCCGGCTGGCGCTGTGCGCCCGAGTCC TCTTGGCTGACAAGGATGGGGAGTCAACTCCATCAGATGAGGTGCTGGACGAAATTGTACCAGAGTACCA GGCCCCTGGGAAGAAGAGCATGCTGGCAATCTGGCAACTGGACCCCGGGGACGTGAGCTTGGTCAAGTAC AAGCAGGCGCTGCTGGGACCCCTGCCACCCATTATGGACCCCAGCCTGCCCAACGTGCAGGTGACTAGGC TGACACTGCTGACGGAGCAGGCTCCAGGGCCTATCATCATGGACCTTACAGGAGACCTAGATGCACTGAA AAACCAGGTGTTTGTCCTGAAGGAGGGCATTGAATACAAGGTGAAGATCACCTTCAAGGTCAACAAGGAG ATTGTCAGTGGCCTCAAATGTCTGCATCACACCTATCGTCGGGGACTGCGTGTGGACAAGGCCATCTTCA TGGTGGGAAGCTACGGCCCCAGAGCCCAGGAGTATGAATTTGTGACTTCAGTGGAGGAAGCACCAAGAGG AGCATTGGCACGTGGCCTCTACGTGGTCAGGTCCCTCTTCACTGATGACGACAGGCTGAACCACCTGTCC TGGGAGTGGCACCTCCATGTCTGCCAGGACTGGAAGGACTGAACCCCACTTGGGGTCTGTATTCCCAATT TCTTGTCAGTTGCAGAGACCTGCAAGCATTCCCTAGACCTCCCAGTTGGTGACCAGATGTCCCCCACTCT CTGCTGTGTCCCCCCTGCCTGGTGCCTATTAAATGTTACCTTGTCTTGCAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_008113
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002032, AAH02032
RefSeq Size 1049 bp
RefSeq ORF 678 bp
Locus ID 14570
UniProt ID Q62160
Gene Summary Inhibits GDP/GTP exchange reaction of RhoB. Interacts specifically with the GDP- and GTP-bound forms of post-translationally processed Rhob and Rhog proteins, both of which show a growth-regulated expression in mammalian cells. Stimulates the release of the GDP-bound but not the GTP-bound RhoB protein. Also inhibits the GDP/GTP exchange of RhoB but shows less ability to inhibit the dissociation of prebound GTP.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...