Arhgdig (NM_008113) Mouse Untagged Clone
CAT#: MC200058
Arhgdig (untagged) - Mouse Rho GDP dissociation inhibitor (GDI) gamma (Arhgdig), (10ug)
CNY 2400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Gdi5; Rho-GDI-3; Rho-GDI2; RIP2 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002032 sequence for NM_008113
CGGACGCGTGGGCGACCGGGTTCCGGCGCGGTGCGGACGAAACGCGCGTCTCTGCGGGCTGCGCGGGGTC CGCGGAGCGGCTGGGGGCGCGCGGCGCGGGCGCGGCGCTGGGCGCGGGGGGCGCTCCCGGCCGGGATGAG CTCACCGCAGTCGCGCCGGGGCTGAGCCGAGCGGGCGGCGGCTCCGCGGCGGGCCGCGGCTACCATGCTG GGCCTGGACGCGTGTGAGCTGGGGGAGCAGCTGTTGGAGCTGCTCCGGCTGGCGCTGTGCGCCCGAGTCC TCTTGGCTGACAAGGATGGGGAGTCAACTCCATCAGATGAGGTGCTGGACGAAATTGTACCAGAGTACCA GGCCCCTGGGAAGAAGAGCATGCTGGCAATCTGGCAACTGGACCCCGGGGACGTGAGCTTGGTCAAGTAC AAGCAGGCGCTGCTGGGACCCCTGCCACCCATTATGGACCCCAGCCTGCCCAACGTGCAGGTGACTAGGC TGACACTGCTGACGGAGCAGGCTCCAGGGCCTATCATCATGGACCTTACAGGAGACCTAGATGCACTGAA AAACCAGGTGTTTGTCCTGAAGGAGGGCATTGAATACAAGGTGAAGATCACCTTCAAGGTCAACAAGGAG ATTGTCAGTGGCCTCAAATGTCTGCATCACACCTATCGTCGGGGACTGCGTGTGGACAAGGCCATCTTCA TGGTGGGAAGCTACGGCCCCAGAGCCCAGGAGTATGAATTTGTGACTTCAGTGGAGGAAGCACCAAGAGG AGCATTGGCACGTGGCCTCTACGTGGTCAGGTCCCTCTTCACTGATGACGACAGGCTGAACCACCTGTCC TGGGAGTGGCACCTCCATGTCTGCCAGGACTGGAAGGACTGAACCCCACTTGGGGTCTGTATTCCCAATT TCTTGTCAGTTGCAGAGACCTGCAAGCATTCCCTAGACCTCCCAGTTGGTGACCAGATGTCCCCCACTCT CTGCTGTGTCCCCCCTGCCTGGTGCCTATTAAATGTTACCTTGTCTTGCAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_008113 |
| Insert Size | 678 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002032, AAH02032 |
| RefSeq Size | 1049 bp |
| RefSeq ORF | 678 bp |
| Locus ID | 14570 |
| UniProt ID | Q62160 |
| Gene Summary | Inhibits GDP/GTP exchange reaction of RhoB. Interacts specifically with the GDP- and GTP-bound forms of post-translationally processed Rhob and Rhog proteins, both of which show a growth-regulated expression in mammalian cells. Stimulates the release of the GDP-bound but not the GTP-bound RhoB protein. Also inhibits the GDP/GTP exchange of RhoB but shows less ability to inhibit the dissociation of prebound GTP.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MR202640 | Arhgdig (Myc-DDK-tagged) - Mouse Rho GDP dissociation inhibitor (GDI) gamma (Arhgdig) |
CNY 2400.00 |
|
| MR202640L3 | Lenti ORF clone of Arhgdig (Myc-DDK-tagged) - Mouse Rho GDP dissociation inhibitor (GDI) gamma (Arhgdig) |
CNY 4750.00 |
|
| MR202640L4 | Lenti ORF clone of Arhgdig (mGFP-tagged) - Mouse Rho GDP dissociation inhibitor (GDI) gamma (Arhgdig) |
CNY 4750.00 |
其它Arhgdig产品
