MHF2 (CENPX) (NM_144998) Human 3' UTR Clone

CAT#: SC208323

3' UTR clone of stimulated by retinoic acid 13 homolog (mouse) (STRA13) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MHF2 (CENPX) (NM_144998) Human 3' UTR Clone
Vector pMirTarget
Synonyms CENP-X; D9; FAAP10; MHF2; STRA13
ACCN NM_144998
Insert Size 532 bp
Sequence Data
>SC208323 3’UTR clone of NM_144998
The sequence shown below is from the reference sequence of NM_144998. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGCTTCCGCAGCTGCTCCTGGACTTCTAGGGATCTCAGCCGTGGCTGAGGCCACCCCCAGAGGAGCCC
CTGGTCCACAGAAGCAGGCCTTGTGTTTCCAGCGGCCTCTGATAAGAGGCAGGGAAGGACCTGAAGGAT
TTGGAGTTGATTCAAACAAGATCTCTGGGAGTCTCCAGCCTGTGCAGAAGGGGCAGGACTGCAGTGCAC
TGCGGGCCTTGGAGTGTCCAGTGGGGACACTGGTGTGGGAAGGGGCAGCACCTGGGGAGTCCCTGCCTC
TCCTCCCTGGGACAATAGTGTGCATGCCACCCGGGGTCCTACAGGCAGGTGCTGGGAAAGGCCTGGCCA
GCAGGTAGCCTGTGTGTTTGACAAACAGCAGCTGGCAGCGCTGCCTCCTGCCCACATTCCTGCCACCCG
ACATCAAAGCTGGCGTGTGACCTTTCCAGCCATGCGATATTCCCCTTGGAAGATGCTTCCCCAGGCTAT
AAATTTGTTCTCACAAAGCAACATCAATAAATCAAAACTGTCTCTCCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_144998.4
Synonyms CENP-X; D9; FAAP10; MHF2; STRA13
Summary DNA-binding component of the Fanconi anemia (FA) core complex. Required for the normal activation of the FA pathway, leading to monoubiquitination of the FANCI-FANCD2 complex in response to DNA damage, cellular resistance to DNA cross-linking drugs, and prevention of chromosomal breakage (PubMed:20347428, PubMed:20347429). In complex with CENPS (MHF heterodimer), crucial cofactor for FANCM in both binding and ATP-dependent remodeling of DNA. Stabilizes FANCM. In complex with CENPS and FANCM (but not other FANC proteins), rapidly recruited to blocked forks and promotes gene conversion at blocked replication forks (PubMed:20347428, PubMed:20347429). In complex with CENPS, CENPT and CENPW (CENP-T-W-S-X heterotetramer), involved in the formation of a functional kinetochore outer plate, which is essential for kinetochore-microtubule attachment and faithful mitotic progression (PubMed:19620631). As a component of MHF and CENP-T-W-S-X complexes, binds DNA and bends it to form a nucleosome-like structure (PubMed:20347428, PubMed:20347429). DNA-binding function is fulfilled in the presence of CENPS, with the following preference for DNA substates: Holliday junction > double-stranded > splay arm > single-stranded. Does not bind DNA on its own (PubMed:20347429).[UniProtKB/Swiss-Prot Function]
Locus ID 201254
MW 19
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...