HTRA2 (NM_013247) Human 3' UTR Clone

CAT#: SC207610

3' UTR clone of HtrA serine peptidase 2 (HTRA2) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HTRA2 (NM_013247) Human 3' UTR Clone
Vector pMirTarget
Synonyms MGCA8; OMI; PARK13; PRSS25
ACCN NM_013247
Insert Size 364 bp
Sequence Data
>SC207610 3’UTR clone of NM_013247
The sequence shown below is from the reference sequence of NM_013247. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTATATGTGACCCCTGAGGTCACAGAATGAATAGATCACCAAGAGTATGAGGCTCCTGCTCTGATTTCC
TCCTTGCCTTTCTGGCTGAGGTTCTGAGGGCACCGAGACAGAGGGTTAAATGAACCAGTGGGGGCAGGT
CCCTCCAACCACCAGCACTGACTCCTGGGCTCTGAAGAATCACAGAAACACTTTTTATATAAAATAAAA
TTATACCTAGCAACATATTATAGTAAAAAATGAGGTGGGAGGGCTGGATCTTTTCCCCCACCAAAAGGC
TAGAGGTAAAGCTGTATCCCCCTAAACTTAGGGGAGATACTGGAGCTGACCATCCTGACCTCCTATTAA
AGAAAATGAGCTGCTGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013247.5
Synonyms MGCA8; OMI; PARK13; PRSS25
Summary This gene encodes a serine protease. The protein has been localized in the endoplasmic reticulum and interacts with an alternatively spliced form of mitogen-activated protein kinase 14. The protein has also been localized to the mitochondria with release to the cytosol following apoptotic stimulus. The protein is thought to induce apoptosis by binding the apoptosis inhibitory protein baculoviral IAP repeat-containing 4. Nuclear localization of this protein has also been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
Locus ID 27429
MW 13.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...