GTF2H2 (NM_001515) Human 3' UTR Clone

CAT#: SC207413

3' UTR clone of general transcription factor IIH polypeptide 2 44kDa (GTF2H2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GTF2H2 (NM_001515) Human 3' UTR Clone
Vector pMirTarget
Synonyms BTF2; BTF2 p44; BTF2P44; p44; T-BTF2P44; TFIIH
ACCN NM_001515
Insert Size 360 bp
Sequence Data
>SC207413 3’UTR clone of NM_001515
The sequence shown below is from the reference sequence of NM_001515. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATAAGATTCCAGCTCCTTCAGGTGTTTGATTCCAGCATGTAGTATACATTGTATGTGTTAAAAAGAAA
TTTGCAACTGTGAATAAAAGGACTTCTTTAGAAGAAGCTTCATTTAAAACATGAAAGGATAATCTGACT
TAAGAAACTTTTTGCTAAGAAAAGGTAATATTTTATTAAATTTTAAATTTGTGTTGTCACAGAAATACC
TGAAATTCAGTAGTACTTCATTCAATTAATTTTGTTTTCTATTATTTTGAGTTATACTGTTTTCAAAGT
CATTATGCAGTATGTATAAACTTATAAGAATTAAATTGATGTGATAATTTTATGTTTTTATAATTAAAT
ATAGAATCTTTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001515.4
Synonyms BTF2; BTF2 p44; BTF2P44; p44; T-BTF2P44; TFIIH
Summary This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. This gene is within the telomeric copy of the duplication. Deletion of this gene sometimes accompanies deletion of the neighboring SMN1 gene in spinal muscular atrophy (SMA) patients but it is unclear if deletion of this gene contributes to the SMA phenotype. This gene encodes the 44 kDa subunit of RNA polymerase II transcription initiation factor IIH which is involved in basal transcription and nucleotide excision repair. Transcript variants for this gene have been described, but their full length nature has not been determined. A second copy of this gene within the centromeric copy of the duplication has been described in the literature. It is reported to be different by either two or four base pairs; however, no sequence data is currently available for the centromeric copy of the gene. [provided by RefSeq, Jul 2008]
Locus ID 2966
MW 14
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...