MAP3K4 (NM_005922) Human 3' UTR Clone

CAT#: SC207147

3' UTR clone of mitogen-activated protein kinase kinase kinase 4 (MAP3K4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MAP3K4 (NM_005922) Human 3' UTR Clone
Vector pMirTarget
Synonyms MAPKKK4; MEKK 4; MEKK4; MTK1; PRO0412
ACCN NM_005922
Insert Size 540 bp
Sequence Data
>SC207147 3’UTR clone of NM_005922
The sequence shown below is from the reference sequence of NM_005922. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTGTCAAGGTTTGCACAGATGAAGAATGAAGCCTAGTAGAATATGGACTTGGAAAATTCTCTTAATCA
CTACTGTATGTAATATTTACATAAAGACTGTGCTGAGAAGCAGTATAAGCCTTTTTAACCTTCCAAGAC
TGAAGACTGCACAGGTGACAAGCGTCACTTCTCCTGCTGCTCCTGTTTGTCTGATGTGGCAAAAGGCCC
TCTGGAGGGCTGGTGGCCACGAGGTTAAAGAAGCTGCATGTTAAGTGCCATTACTACTGTACACGGACC
ATCGCCTCTGTCTCCTCCGTGTCTCGCGCGACTGAGAACCGTGACATCAGCGTAGTGTTTTGACCTTTC
TAGGTTCAAAAGAAGTTGTAGTGTTATCAGGCGTCCCATACCTTGTTTTTAATCTCCTGTTTGTTGAGT
GCACTGACTGTGAAACCTTTACCTTTTTTGTTGTTGTTGGCAAGCTGCAGGTTTGTAATGCAAAAGGCT
GATTACTGAAATTTAAGAAAAAGGTTCTTTTTTCAATAAATGGTTTATTTTAGGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005922.4
Synonyms MAPKKK4; MEKK 4; MEKK4; MTK1; PRO0412
Summary The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
Locus ID 4216
MW 20.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...