KHDRBS3 (NM_006558) Human 3' UTR Clone

CAT#: SC207096

3' UTR clone of KH domain containing RNA binding signal transduction associated 3 (KHDRBS3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name KHDRBS3 (NM_006558) Human 3' UTR Clone
Vector pMirTarget
Synonyms Etle; etoile; SALP; SLM-2; SLM2; T-STAR; TSTAR
ACCN NM_006558
Insert Size 556 bp
Sequence Data
>SC207096 3’UTR clone of NM_006558
The sequence shown below is from the reference sequence of NM_006558. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TACAGAGACCAGCCATATGGCAGATACTGATTGTACTGTCTGATGTTGTGAAATAGCCAATCTCCACCA
GTCCTGTATACTGTTCAAAGTAATTTTTTTCTATGAACAATCCCTTTTTAAATAAATCAGAATGCTTAA
AATCTGAATGGATGGAACTTAAAACTACTTTGTTGAAACATCAACCTGGGCAGAAAAAAAAAAAAAAAG
ACATGTAAAATTTTGTTATTTCCAGTCTGTATATGAAAAAATAGGTCATCAAAAGGAAAAAAAATAACT
TTGATTAACTAGTGTTAAACAAAAAATAGGTTTACTAAATATGTTAATCTATTCTTTTAACATAAGCCT
CACCTTTCATTTTAAAGGTTTCCATAGAATTTAGTTATTTTATCTTTCAGCCATATGCTAGTTTTTTTT
TCTCTTGCCAACATGCGTAAAAAGGGAAGCCAATTACAAGTGCAAATAATGTGGTATTCTTTTGTAACT
CAAGTCTTGAAATGTTCTGTAGTGTTAAGCAAAGTCTCCTCTTGCTTGATACTAAATAAACTTTTGAAA
GAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006558.3
Synonyms Etle; etoile; SALP; SLM-2; SLM2; T-STAR; TSTAR
Summary RNA-binding protein that plays a role in the regulation of alternative splicing and influences mRNA splice site selection and exon inclusion. Binds preferentially to the 5'-[AU]UAAA-3' motif in vitro. Binds optimally to RNA containing 5'-[AU]UAA-3' as a bipartite motif spaced by more than 15 nucleotides. Binds poly(A). RNA-binding abilities are down-regulated by tyrosine kinase PTK6 (PubMed:10564820, PubMed:19561594, PubMed:26758068). Involved in splice site selection of vascular endothelial growth factor (PubMed:15901763). In vitro regulates CD44 alternative splicing by direct binding to purine-rich exonic enhancer (By similarity). Can regulate alternative splicing of neurexins NRXN1-3 in the laminin G-like domain 6 containing the evolutionary conserved neurexin alternative spliced segment 4 (AS4) involved in neurexin selective targeting to postsynaptic partners such as neuroligins and LRRTM family members (PubMed:26758068). Targeted, cell-type specific splicing regulation of NRXN1 at AS4 is involved in neuronal glutamatergic synapse function and plasticity (By similarity). May regulate expression of KHDRBS2/SLIM-1 in defined brain neuron populations by modifying its alternative splicing (By similarity). Can bind FABP9 mRNA (By similarity). May play a role as a negative regulator of cell growth. Inhibits cell proliferation.[UniProtKB/Swiss-Prot Function]
Locus ID 10656
MW 21.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...