RAD17 (NM_133341) Human 3' UTR Clone

CAT#: SC207053

3' UTR clone of RAD17 homolog (S. pombe) (RAD17) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name RAD17 (NM_133341) Human 3' UTR Clone
Vector pMirTarget
Synonyms CCYC; HRAD17; R24L; RAD17SP; RAD24
ACCN NM_133341
Insert Size 556 bp
Sequence Data
>SC207053 3’UTR clone of NM_133341
The sequence shown below is from the reference sequence of NM_133341. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAGAAGACTACGAGAGTGATGGGACATAGAAGCCAGCCTGCTAATCAGATTGCTACTTCACAGCTTCA
TTTTTGTTTCATTCAGTGGTACTTCAGCAGAGTTAATATGCTTTTCTGATGAATTACACAACAGTTTGT
TAATTCTTCATTCTTGTAGTATTTCATCACAAGAAACCTACTCTTCTGTCATCTTGAAGTAAATAGAAG
ATCAAGCCTTCAAATCTCTTAATTTTTTCGGTATTTATTAAATCTGTGAGTGGTTTAAGGAGCGGTCAG
TGTGTATAAAGTGTGTTTGAACATTATGCCAAATATCAAGATGTGAAGGACTAATTCAGGATGCAAAAA
CGTTATTGGGGGGTTGTAAATATCAACTATTCAACAGTTTAGGATGCAATTACGAGTGTAAACTGTGTG
CCTTATTTACACTTTATTGTCTCCCGCTTCTCAGATAGTTTTGATGTGTTGTACAGTGGAATATCTTAG
ATACTTTTTGGAAAGTATTTACATAAGTTATATCACAATTAAAATGTTGAATTTAAAAAAAAAAAAAAA
AAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_133341.2
Synonyms CCYC; HRAD17; R24L; RAD17SP; RAD24
Summary The protein encoded by this gene is highly similar to the gene product of Schizosaccharomyces pombe rad17, a cell cycle checkpoint gene required for cell cycle arrest and DNA damage repair in response to DNA damage. This protein shares strong similarity with DNA replication factor C (RFC), and can form a complex with RFCs. This protein binds to chromatin prior to DNA damage and is phosphorylated by the checkpoint kinase ATR following damage. This protein recruits the RAD1-RAD9-HUS1 checkpoint protein complex onto chromatin after DNA damage, which may be required for its phosphorylation. The phosphorylation of this protein is required for the DNA-damage-induced cell cycle G2 arrest, and is thought to be a critical early event during checkpoint signaling in DNA-damaged cells. Multiple alternatively spliced transcript variants of this gene, which encode four distinct protein isoforms, have been reported. Two pseudogenes, located on chromosomes 7 and 13, have been identified. [provided by RefSeq, Jul 2013]
Locus ID 5884
MW 21.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...