Cathepsin F (CTSF) (NM_003793) Human 3' UTR Clone

CAT#: SC206576

3' UTR clone of cathepsin F (CTSF) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cathepsin F (CTSF) (NM_003793) Human 3' UTR Clone
Vector pMirTarget
Synonyms CATSF; CLN13
ACCN NM_003793
Insert Size 499 bp
Sequence Data
>SC206576 3’UTR clone of NM_003793
The sequence shown below is from the reference sequence of NM_003793. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCATGGCCAGCTCGGCGGTGGTGGACTGAAGAGGGGCCCCCAGCTCGGGACCTGGTGCTGATCAGAGT
GGCTGCTGCCCCAGCCTGACATGTGTCCAGGCCCCTCCCCGGGAGGTACAGCTGGCAGAGGGAAAGGCA
CTGGGTACCTCAGGGTGAGCAGAGGGCACTGGGCTGGGGCACAGCCCCTGCTTCCCTGCACCCCATTCC
CACCCTGAAGTTCTGCACCTGCACCTTTGTTGAATTGTGGTAGCTTAGGAGGATGTCGGGGTGAAGGGT
GGTATCTTGGCAGTTGAAGCTGGGGCAAGAACTCTGGGCTTGGGTAATGAGCAGGAAGAAAATTTTCTG
ATCTTAAGCCCAGCTCTGTTCTGCCCCCGCTTTCCTCTGTTTGATACTATAAATTTTCTGGTTCCCTTG
GATTTAGGGATAGTGTCCCTCTCCATGTCCAGGAAACTTGTAACCACCCTTTTCTAACAGCAATAAAGA
GGTGTCCTTGTCCCGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003793.4
Synonyms CATSF; CLN13
Summary Cathepsins are papain family cysteine proteinases that represent a major component of the lysosomal proteolytic system. Cathepsins generally contain a signal sequence, followed by a propeptide and then a catalytically active mature region. The very long (251 amino acid residues) proregion of the cathepsin F precursor contains a C-terminal domain similar to the pro-segment of cathepsin L-like enzymes, a 50-residue flexible linker peptide, and an N-terminal domain predicted to adopt a cystatin-like fold. The cathepsin F proregion is unique within the papain family cysteine proteases in that it contains this additional N-terminal segment predicted to share structural similarities with cysteine protease inhibitors of the cystatin superfamily. This cystatin-like domain contains some of the elements known to be important for inhibitory activity. CTSF encodes a predicted protein of 484 amino acids which contains a 19 residue signal peptide. Cathepsin F contains five potential N-glycosylation sites, and it may be targeted to the endosomal/lysosomal compartment via the mannose 6-phosphate receptor pathway. The cathepsin F gene is ubiquitously expressed, and it maps to chromosome 11q13, close to the gene encoding cathepsin W. [provided by RefSeq, Jul 2008]
Locus ID 8722
MW 17.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...