WIBG (PYM1) (NM_001143853) Human 3' UTR Clone

CAT#: SC206452

3' UTR clone of within bgcn homolog (Drosophila) (WIBG) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name WIBG (PYM1) (NM_001143853) Human 3' UTR Clone
Vector pMirTarget
Synonyms PYM; WIBG
ACCN NM_001143853
Insert Size 507 bp
Sequence Data
>SC206452 3’UTR clone of NM_001143853
The sequence shown below is from the reference sequence of NM_001143853. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGTTAGAGGACTTGGAGTTAGGCCTCTGAGGCCTTTGGGGAATAGGGAATGGACTGCAGAACAAACCG
TGGGGCTCTCTGGGGTCTGGGGGAATACGGGCAACAGCAGTCAGGAGGGGTACCCCCCATACTGGCTTA
CTTCCACCTCCTGCGGCCCAGCTCTGTCCTCCAGAGCCTAGCGTCTCCCTCAATCCTTCCCTTTTCTTC
CCAACTTCTACTTTTTGGACTTTCCCCCTCCCATTCCCAGTGTTCAAAATCTCAGTGACTACCCCAGGT
ACCTTTGCTGCTGATTTGGGTGTCTTGTTTAAAAGAAAATCAGGTGGGTGGGAATCTCTTGGAGAACTG
AGGCTGAGGGTAGAGGGAGTATGCCCAAGTCTTGGAGTCTTGGTTCCTGTTCGCGGTGTTTATGGGTTA
TTTCCCTCTCCATCCCTCATTTTTTTTTTTTTTTTAAAAAAAGCAAAAATGAGAATAAACACAAGTAGA
CATGTCAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001143853.1
Synonyms PYM; WIBG
Summary Key regulator of the exon junction complex (EJC), a multiprotein complex that associates immediately upstream of the exon-exon junction on mRNAs and serves as a positional landmark for the intron exon structure of genes and directs post-transcriptional processes in the cytoplasm such as mRNA export, nonsense-mediated mRNA decay (NMD) or translation. Acts as an EJC disassembly factor, allowing translation-dependent EJC removal and recycling by disrupting mature EJC from spliced mRNAs. Its association with the 40S ribosomal subunit probably prevents a translation-independent disassembly of the EJC from spliced mRNAs, by restricting its activity to mRNAs that have been translated. Interferes with NMD and enhances translation of spliced mRNAs, probably by antagonizing EJC functions. May bind RNA; the relevance of RNA-binding remains unclear in vivo, RNA-binding was detected by PubMed:14968132, while PubMed:19410547 did not detect RNA-binding activity independently of the EJC.[UniProtKB/Swiss-Prot Function]
Locus ID 84305
MW 18.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...