GSTM4 (NM_147148) Human 3' UTR Clone

CAT#: SC206369

3' UTR clone of glutathione S-transferase mu 4 (GSTM4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GSTM4 (NM_147148) Human 3' UTR Clone
Vector pMirTarget
Synonyms GSTM4-4; GTM4
ACCN NM_147148
Insert Size 496 bp
Sequence Data
>SC206369 3’UTR clone of NM_147148
The sequence shown below is from the reference sequence of NM_147148. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCTTTGAGGTTTCCTGTGGCATAATGTGATGGTCAATTTTCTGCATCAACTTGACTGGGCTAAGGGAT
GCTCAGATGGCAGGTAAAATCATTGTGCTTGTGAGGGTGTTTCCAGAAGAGATTTGCCTTTGAATCAGA
AGACAGCAAAGATTTCCTTCAGCAATGAAGGAGGCATCCACCAAACTGTCAGGGCCCAGAGAGAAGAAA
AAGACAGGAAGGGTGAATTTGACCTCTCTGACTGGGACATCCATCTCTGCCTATCCTGGGACCTCCACA
CTCCTGGTTCTCTGGCCTTCAGACTTGATCAGGGACTAACACCATCGCCTCCCACCCCCACCTTTGTTC
TGAGGCCTTTAGCCTCTGAATGATACCACTGGCTTTCCTGCTTCTCTATCCTGCAGTCGGCAGATCATG
GGACTTCTTCACTCCAAAATTGTGTGAGCCAATTCCCATAACAGATAGATAAATTTATAAATAAACACA
CAAATTTCCTACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_147148.3
Synonyms GSTM4-4; GTM4
Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. Diversification of these genes has occurred in regions encoding substrate-binding domains, as well as in tissue expression patterns, to accommodate an increasing number of foreign compounds. Multiple transcript variants, each encoding a distinct protein isoform, have been identified. [provided by RefSeq, Jul 2008]
Locus ID 2948
MW 18.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...