NR2F6 (NM_005234) Human 3' UTR Clone

CAT#: SC206312

3' UTR clone of nuclear receptor subfamily 2 group F member 6 (NR2F6) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NR2F6 (NM_005234) Human 3' UTR Clone
Vector pMirTarget
Synonyms EAR-2; EAR2; ERBAL2
ACCN NM_005234
Insert Size 499 bp
Sequence Data
>SC206312 3’UTR clone of NM_005234
The sequence shown below is from the reference sequence of NM_005234. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTCAACTGGCCCTACGGCTCGGGCCAGTGACCATGACGGGGCCACGTGTGCTGTGGCCAGGCCTGCAGA
CAGACCTCAAGGGACAGGGAATGCTGAGGCCTCGAGGGGCCTCCCGGGGCCCAGGACTCTGGCTTCTCT
CCTCAGACTTCTATTTTTTAAAGACTGTGAAATGTTTGTCTTTTCTGTTTTTTAAATGATCATGAAACC
AAAAAGAGACTGATCATCCAGGCCTCAGCCTCATCCTCCCCAGGACCCCTGTCCAGGATGGAGGGTCCA
ATCCTAGGACAGCCTTGTTCCTCAGCACCCCTAGCATGAACTTGTGGGATGGTGGGGTTGGCTTCCCTG
GCATGATGGACAAAGGCCTGGCGTCGGCCAGAGGGGCTGCTCCAGTGGGCAGGGGTAGCTAGCGTGTGC
CAGGCAGATCCTCTGGACACGTAACCTATGTCAGACACTACATGATGACTCAAGGCCAATAATAAAGAC
ATTTCCTACCTGCACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005234.4
Synonyms EAR-2; EAR2; ERBAL2
Summary Transcription factor predominantly involved in transcriptional repression. Binds to promoter/enhancer response elements that contain the imperfect 5'-AGGTCA-3' direct or inverted repeats with various spacings which are also recognized by other nuclear hormone receptors. Involved in modulation of hormonal responses. Represses transcriptional activity of the lutropin-choriogonadotropic hormone receptor/LHCGR gene, the renin/REN gene and the oxytocin-neurophysin/OXT gene. Represses the triiodothyronine-dependent and -independent transcriptional activity of the thyroid hormone receptor gene in a cell type-specific manner. The corepressing function towards thyroid hormone receptor beta/THRB involves at least in part the inhibition of THRB binding to triiodothyronine response elements (TREs) by NR2F6. Inhibits NFATC transcription factor DNA binding and subsequently its transcriptional activity. Acts as transcriptional repressor of IL-17 expression in Th-17 differentiated CD4(+) T cells and may be involved in induction and/or maintenance of peripheral immunological tolerance and autoimmunity. Involved in development of forebrain circadian clock; is required early in the development of the locus coeruleus (LC).[UniProtKB/Swiss-Prot Function]
Locus ID 2063
MW 18
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...