ALK (NM_004304) Human 3' UTR Clone

CAT#: SC206101

3' UTR clone of anaplastic lymphoma receptor tyrosine kinase (ALK) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ALK (NM_004304) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD246; NBLST3
ACCN NM_004304
Insert Size 480 bp
Sequence Data
>SC206101 3’UTR clone of NM_004304
The sequence shown below is from the reference sequence of NM_004304. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAATAGCATGAACCAGCCTGGGCCCTGAGCTCGGTCGCACACTCACTTCTCTTCCTTGGGATCCCTA
AGACCGTGGAGGAGAGAGAGGCAATGGCTCCTTCACAAACCAGAGACCAAATGTCACGTTTTGTTTTGT
GCCAACCTATTTTGAAGTACCACCAAAAAAGCTGTATTTTGAAAATGCTTTAGAAAGGTTTTGAGCATG
GGTTCATCCTATTCTTTCGAAAGAAGAAAATATCATAAAAATGAGTGATAAATACAAGGCCCAGATGTG
GTTGCATAAGGTTTTTATGCATGTTTGTTGTATACTTCCTTATGCTTCTTTCAAATTGTGTGTGCTCTG
CTTCAATGTAGTCAGAATTAGCTGCTTCTATGTTTCATAGTTGGGGTCATAGATGTTTCCTTGCCTTGT
TGATGTGGACATGAGCCATTTGAGGGGAGAGGGAACGGAAATAAAGGAGTTATTTGTAATGACTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004304.5
Synonyms CD246; NBLST3
Summary This gene encodes a receptor tyrosine kinase, which belongs to the insulin receptor superfamily. This protein comprises an extracellular domain, an hydrophobic stretch corresponding to a single pass transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and exerts its effects on specific neurons in the nervous system. This gene has been found to be rearranged, mutated, or amplified in a series of tumours including anaplastic large cell lymphomas, neuroblastoma, and non-small cell lung cancer. The chromosomal rearrangements are the most common genetic alterations in this gene, which result in creation of multiple fusion genes in tumourigenesis, including ALK (chromosome 2)/EML4 (chromosome 2), ALK/RANBP2 (chromosome 2), ALK/ATIC (chromosome 2), ALK/TFG (chromosome 3), ALK/NPM1 (chromosome 5), ALK/SQSTM1 (chromosome 5), ALK/KIF5B (chromosome 10), ALK/CLTC (chromosome 17), ALK/TPM4 (chromosome 19), and ALK/MSN (chromosome X).[provided by RefSeq, Jan 2011]
Locus ID 238
MW 18.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...