NMDAR2C (GRIN2C) (NM_000835) Human 3' UTR Clone

CAT#: SC205926

3' UTR clone of glutamate receptor ionotropic N-methyl D-aspartate 2C (GRIN2C) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NMDAR2C (GRIN2C) (NM_000835) Human 3' UTR Clone
Vector pMirTarget
Synonyms GluN2C; NMDAR2C; NR2C
ACCN NM_000835
Insert Size 442 bp
Sequence Data
>SC205926 3’UTR clone of NM_000835
The sequence shown below is from the reference sequence of NM_000835. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGGATCTCCAGTCTGGAGTCAGAAGTGTGAGTTATCAGCCACTCAGGCTCCGAGCCAGCTGGATTCTCT
GCCTGCCACTGTCAGGGTTAAGCGGCAGGCAGGATTGGGCTTTTCTGGCTTCTGCCATGAAATCCTGGC
CATGGGACCCCAGTGACAGATGATGTCTTCCATGGTCATCAGTGACCTCAGTAGCCTCAAATCATGGTG
AGGGCTGGGCTTTTGCTGTCCTCTTCTCACGCAGAGTTCTGCCAGGAGGGTGTGCTGTGGGGGTCAGAC
TCCTGAGGCTCTCCCTTCCCTGGGGCTAGCCAGTTACTGGTCATGGCTGCTGTGGGCATGGAGGCTGGA
ACTTGTGGTTGAGGCAGGGCCATCCCGATCCTTGCTCTACCTGGCTAGAGTTTCTTCTCATCAGAGCAC
TGGGACATTAAACCAACCTTTTACAACA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000835.6
Synonyms GluN2C; NMDAR2C; NR2C
Summary This gene encodes a subunit of the N-methyl-D-aspartate (NMDA) receptor, which is a subtype of ionotropic glutamate receptor. NMDA receptors are found in the central nervous system, are permeable to cations and have an important role in physiological processes such as learning, memory, and synaptic development. The receptor is a tetramer of different subunits (typically heterodimer of subunit 1 with one or more of subunits 2A-D), forming a channel that is permeable to calcium, potassium, and sodium, and whose properties are determined by subunit composition. Alterations in the subunit composition of the receptor are associated with pathophysiological conditions such as Parkinson's disease, Alzheimer's disease, depression, and schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Locus ID 2905
MW 15.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...