PES1 (NM_014303) Human 3' UTR Clone

CAT#: SC205900

3' UTR clone of pescadillo homolog 1 containing BRCT domain (zebrafish) (PES1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5464.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PES1 (NM_014303) Human 3' UTR Clone
Vector pMirTarget
Synonyms NOP7; PES
ACCN NM_014303
Insert Size 458 bp
Sequence Data
>SC205900 3' UTR clone of NM_014303
The sequence shown below is from the reference sequence of NM_014303. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

TGAGGTCTGAGAAGAAGGCCAAGAAGGCAAGGCCGGAGTGAGTGCCTGCGGCCCCTCACAGGGCTGAGGC
CAGCCCCTAGCAGCTGGATGTGGCAGAGGCAGGCCAGAGGACCTAAGTGTGATGGACCAGAGTCACTTCT
CCTCCTCCTTTCTCCAGCCAGCCCTGACCCCTCATGCTCTCTGGCTGGGCCAGTGGGCAGCCCTCGCTTC
CCTTGGATGGAGCTGCCCTGCTGGTGCCTGGTCAGAGAAGAGGCCTCTGTGCCCAGCCTGATTCTCTGCT
CCCAGGAGCCAGTGACATGAGGTGCAGAGGCCCACCCAGCCCCCTACCTACTGCCCCCATTCATCCTGGC
TTTCCACAGCCCCCTCCCACACAGTTGGACCCGTGATTCTCAGGGTGCTGTGATGGGGTGAGGGTAGGGG
GAGCATTTGTTATTAAATGACTGGACTTTTGTGCCAAT

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014303.2
Synonyms NOP7; PES
Summary This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
Locus ID 23481
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...