RNF22 (TRIM3) (NM_033278) Human 3' UTR Clone

CAT#: SC205892

3' UTR clone of tripartite motif-containing 3 (TRIM3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RNF22 (TRIM3) (NM_033278) Human 3' UTR Clone
Vector pMirTarget
Synonyms BERP; HAC1; RNF22; RNF97
ACCN NM_033278
Insert Size 445 bp
Sequence Data
>SC205892 3’UTR clone of NM_033278
The sequence shown below is from the reference sequence of NM_033278. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCTTTAAAGCCTATCGCTACCTCCAGTAGCTGTACAGAGGCCCTGCCTGGCTTGTGGAGGGACAGACA
TTGGGGTGATTGGACAAGAGGGTCTGGCTGGGAGGTGGGCCAGACCTGGCAGCACTGAATGTGGGCTGT
GGGCATGGGTGCACCCGGTGCCCTCCCTCTCCTACCCCCACCCCCACGGTTGCACTTTATTTATTCGGT
TCTTGCTTTGGTGACTGGGTGAGCCTGGACTGTGGTCCCAAGGATGTGTGCAGAGCTTCACCCTACCCT
TCTTACACACCTCCCCACCCCTGTCAGTCTGCTCCCCATCCCCCAGCCTGGGGCCAGAACAGCCTACCC
CAGGACAGGAGTCCCTCTAGTTGTCTCCCTACCACCCTATACACACTGACAGAGACAGCAATACCCCAC
CCCCCATATTAAATAAATGTCTTCACCAAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033278.4
Synonyms BERP; HAC1; RNF22; RNF97
Summary The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
Locus ID 10612
MW 16.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...