Protor 1 (PRR5) (NM_015366) Human 3' UTR Clone

CAT#: SC205855

3' UTR clone of proline rich 5 (renal) (PRR5) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Protor 1 (PRR5) (NM_015366) Human 3' UTR Clone
Vector pMirTarget
Synonyms FLJ20185k; PP610; PROTOR-1; PROTOR1
ACCN NM_015366
Insert Size 464 bp
Sequence Data
>SC205855 3’UTR clone of NM_015366
The sequence shown below is from the reference sequence of NM_015366. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCTCTGGGGGCCGGCAGAGTGTCGTGTGAGGCCTCACAGCTGGCCTTGAGTTTTTACTGACACGTCCC
TGTGTGCGGGGGTGTCCATGTGGCGTGTGTGTGAGTGAGACTTTTTTACTGCGTCCCGTCCCGCCAGCC
CTATCGGCCTCGTCACTGGCCTTGGTCACTTTGTATTTCTGTCTTGGTTGGAAATACCATCAGCCTTCC
TTGCTCGGCCCAGGTCTGTTTCAGGCATCTGAGTCGGCGTTTACCCAGGGGCCGGGCCAGAGACGGGGG
TCGGCCGCTCGCTCCCACGCTCCTCCTGCCCCAGCCCTCTGGTGTCCACACCTGCCCACAGAGAATGTA
AACCCAGTGGGCTCTGCCCACGCCGGGCCCCAAAGTGACCAGACTCCAGCACACCTGTCTCCTCCTGCC
TGGGGTGGCCATGGGGATGGAAGGGGGTGGAATAAAACCTGTCAACCTGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015366.4
Synonyms FLJ20185k; PP610; PROTOR-1; PROTOR1
Summary This gene encodes a protein with a proline-rich domain. This gene is located in a region of chromosome 22 reported to contain a tumor suppressor gene that may be involved in breast and colorectal tumorigenesis. The protein is a component of the mammalian target of rapamycin complex 2 (mTORC2), and it regulates platelet-derived growth factor (PDGF) receptor beta expression and PDGF signaling to Akt and S6K1. Alternative splicing and the use of alternative promoters results in transcripts encoding different isoforms. Read-through transcripts from this gene into the downstream Rho GTPase activating protein 8 (ARHGAP8) gene also exist, which led to the original description of PRR5 and ARHGAP8 being a single gene. [provided by RefSeq, Nov 2010]
Locus ID 55615
MW 16
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...