SEMA6D (NM_024966) Human 3' UTR Clone

CAT#: SC205658

3' UTR clone of sema domain transmembrane domain (TM) and cytoplasmic domain (semaphorin) 6D (SEMA6D) transcript variant 6 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SEMA6D (NM_024966) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_024966
Insert Size 461 bp
Sequence Data
>SC205658 3’UTR clone of NM_024966
The sequence shown below is from the reference sequence of NM_024966. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGATTGAAGCCTACAACCATGCAAAGTAGGTATATGTTACGAGAACGCCCTTCAGCACTGCTCAAAAA
TTTTCGGCATGTATTTCATCTAGTCATGTCCTTTTGGTCCTCTAAATTAGCAGTGGTTTGGCATAATAG
TGTTTTGTGTTTTTTTTCTCATTGAAATAAATCTTGGGTTTGTTTTTTTCCCGAGCCTGCTAGGGCGAG
GGGGGTGAATGGTTGATGAGTTTAAAAATAATGCAGCCCTTGTTTTTCACCTGTAGAATATGAGAACAT
TTTAACAGCACCTCTCTTATCTTGCAGATATATTCCAAGATGCTACATGCAGCAGACAGCTGTGAGCTT
GCATACACACACACACAAATATACATGCACATACATACACAGAATGCAGTACTAGTTAAGTATTTCCTT
CCTATCTTTAATAAGTAAGAGAATATTTAGACCATTAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024966.3
Summary Semaphorins are a large family, including both secreted and membrane associated proteins, many of which have been implicated as inhibitors or chemorepellents in axon pathfinding, fasciculation and branching, and target selection. All semaphorins possess a semaphorin (Sema) domain and a PSI domain (found in plexins, semaphorins and integrins) in the N-terminal extracellular portion. Additional sequence motifs C-terminal to the semaphorin domain allow classification into distinct subfamilies. Results demonstrate that transmembrane semaphorins, like the secreted ones, can act as repulsive axon guidance cues. This gene encodes a class 6 vertebrate transmembrane semaphorin that demonstrates alternative splicing. Several transcript variants have been identified and expression of the distinct encoded isoforms is thought to be regulated in a tissue- and development-dependent manner. [provided by RefSeq, Nov 2010]
Locus ID 80031
MW 17.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...