Complement C5 (C5) (NM_001735) Human 3' UTR Clone

CAT#: SC205644

3' UTR clone of complement component 5 (C5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Complement C5 (C5) (NM_001735) Human 3' UTR Clone
Vector pMirTarget
Synonyms C5a; C5b; C5D; CPAMD4; ECLZB
ACCN NM_001735
Insert Size 434 bp
Sequence Data
>SC205644 3’UTR clone of NM_001735
The sequence shown below is from the reference sequence of NM_001735. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCGAAGATATCTTTTTAAATGGATGCTAAAATTCCTGAAGTTCAGCTGCATACAGTTTGCACTTATGG
ACTCCTGTTGTTGAAGTTCGTTTTTTTGTTTTCTTCTTTTTTTAAACATTCATAGCTGGTCTTATTTGT
AAAGCTCACTTTACTTAGAATTAGTGGCACTTGCTTTTATTAGAGAATGATTTCAAATGCTGTAACTTT
CTGAAATAACATGGCCTTGGAGGGCATGAAGACAGATACTCCTCCAAGGTTATTGGACACCGGAAACAA
TAAATTGGAACACCTCCTCAAACCTACCACTCAGGAATGTTTGCTGGGGCCGAAAGAACAGTCCATTGA
AAGGGAGTATTACAAAAACATGGCCTTTGCTTGAAAGAAAATACCAAGGAACAGGAAACTGATCATTAA
AGCCTGAGTTTGCTTTCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001735.3
Synonyms C5a; C5b; C5D; CPAMD4; ECLZB
Summary This gene encodes a component of the complement system, a part of the innate immune system that plays an important role in inflammation, host homeostasis, and host defense against pathogens. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the C5 alpha chain, C5 beta chain, C5a anaphylatoxin and C5b. The C5 protein is comprised of the C5 alpha and beta chains, which are linked by a disulfide bridge. Cleavage of the alpha chain by a convertase enzyme results in the formation of the C5a anaphylatoxin, which possesses potent spasmogenic and chemotactic activity, and the C5b macromolecular cleavage product, a subunit of the membrane attack complex (MAC). Mutations in this gene cause complement component 5 deficiency, a disease characterized by recurrent bacterial infections. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2015]
Locus ID 727
MW 16.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...