CSPS (SULT1A3) (NM_177552) Human 3' UTR Clone

CAT#: SC205587

3' UTR clone of sulfotransferase family cytosolic 1A phenol-preferring member 3 (SULT1A3) transcript variant 2



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CSPS (SULT1A3) (NM_177552) Human 3' UTR Clone
Vector pMirTarget
Synonyms HAST; HAST3; M-PST; ST1A3; ST1A3/ST1A4; ST1A4; ST1A5; STM; TL-PST
ACCN NM_177552
Insert Size 420 bp
Sequence Data
>SC205587 3’UTR clone of NM_177552
The sequence shown below is from the reference sequence of NM_177552. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TGCAGCCTCAGCTTCCGCTCTGAGCTGTGAGAGGGGCTCCTGGAGTCACTGCAGAGGGAGTGTGCGAAT
CTACCCTGACCAATGGGCTCAAGAATAAAGTATGATTTTTGAGTCAGGCACAGTGGCTCATGTCTGCAA
TCCCAGCGATTTGGGAGGTTGAGCTGGTAGGATCACAATAGGCCACGAATTTGAGACCAGCCTGGTAAA
ATAGTGAGACCTCATCTCTACAAAGATGTAAAAAAATTAGCCACATGTGCTGGCACTTACCTGTAGTCC
CAGCTACTTGGGAAGCAGAGGCTGGAGGATCATTTCAGCCCAGGAGGTTGTGGATACAGTGAGTTATGA
CATGCCCATTCACTACAGCCTGGATGACAAGCAAGACCCTCCCTCCAAAGAAAATAAAGCTCAATTAAA
ATAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_177552.4
Synonyms HAST; HAST3; M-PST; ST1A3; ST1A3/ST1A4; ST1A4; ST1A5; STM; TL-PST
Summary Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a phenol sulfotransferase with thermolabile enzyme activity. Four sulfotransferase genes are located on the p arm of chromosome 16; this gene and SULT1A4 arose from a segmental duplication. This gene is the most centromeric of the four sulfotransferase genes. Read-through transcription exists between this gene and the upstream SLX1A (SLX1 structure-specific endonuclease subunit homolog A) gene that encodes a protein containing GIY-YIG domains. [provided by RefSeq, Nov 2010]
Locus ID 6818
MW 15.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...