LILRB4 (NM_006847) Human 3' UTR Clone

CAT#: SC205231

3' UTR clone of leukocyte immunoglobulin-like receptor subfamily B (with TM and ITIM domains) member 4 (LILRB4) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 5464.00


货期*
现货

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name LILRB4 (NM_006847) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD85K; HM18; ILT3; LILRB5; LIR-5; LIR5
ACCN NM_006847
Insert Size 390 bp
Sequence Data
>SC205231 3' UTR clone of NM_006847
The sequence shown below is from the reference sequence of NM_006847. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGTCTATGCCACTCTGGCCATCCACTAATCCAGGGGGGACCCAGACCCCACAAGCCATGGAGACTCAGG
ACCCCAGAAGGCATGGAAGCTGCCTCCAGTAGACATCACTGAACCCCAGCCAGCCCAGACCCCTGACACA
GACCACTAGAAGATTCCGGGAACGTTGGGAGTCACCTGATTCTGCAAAGATAAATAATATCCCTGCATTA
TCAAAATAAAGTAGCAGACCTCTCAATTCACAATGAGTTAACTGATAAAACAAAACAGAAGTCAGACAAT
GTTTTAAATTGAATGATCATGTAAATATTACACATCAAACCAATGACATGGGAAAATGGGAGCTTCTAAT
GAGGACAAACAAAAAATAGAGAAAAATTAATAAAGTCAAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006847.3
Synonyms CD85K; HM18; ILT3; LILRB5; LIR-5; LIR5
Summary This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. The receptor can also function in antigen capture and presentation. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 11006
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...