DPS1 (PDSS1) (NM_014317) Human 3' UTR Clone

CAT#: SC205171

3' UTR clone of prenyl (decaprenyl) diphosphate synthase subunit 1 (PDSS1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DPS1 (PDSS1) (NM_014317) Human 3' UTR Clone
Vector pMirTarget
Synonyms COQ1; COQ1A; COQ10D2; DPS; hDPS1; SPS; TPRT; TPT; TPT 1
ACCN NM_014317
Insert Size 355 bp
Sequence Data
>SC205171 3’UTR clone of NM_014317
The sequence shown below is from the reference sequence of NM_014317. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAGAAATTGTACTCACAAGAGATAAATGACAACTCTTTCTGTTCTTTCTGGCAGCTATCTTACCAGAC
TGTGCCTAAAGAATTTTGTGGAATACACTTTGTTTGCTTCATGTGCAGATAACCAAAAATCATTTTAAA
AGATATCAAACTTATTGATGGGCAATTTATTTTTTTTTATTGCAAAAGTTTTTTCAGAAAACTTTTTAA
ATGTAATTAATAAACCACCTGAATCTGTCATTCTAGTCCTATAAATTATAATCAAGGTATCTTGATGGT
TATATGTGGTATTGTTTACACTGTTAATATCCACATGTAAGGCCATTACACAAATAAATAACCAATGTT
AAAATTCAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014317.5
Synonyms COQ1; COQ1A; COQ10D2; DPS; hDPS1; SPS; TPRT; TPT; TPT 1
Summary The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
Locus ID 23590
MW 14.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...