Cytochrome P450 Reductase (POR) (NM_000941) Human 3' UTR Clone

CAT#: SC205168

3' UTR clone of P450 (cytochrome) oxidoreductase (POR) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cytochrome P450 Reductase (POR) (NM_000941) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPR; CYPOR; P450R
ACCN NM_000941
Insert Size 404 bp
Sequence Data
>SC205168 3’UTR clone of NM_000941
The sequence shown below is from the reference sequence of NM_000941. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCCGCTACTCCCTGGACGTGTGGAGCTAGGGGCCTGCCTGCCCCACCCACCCCACAGACTCCGGCCTG
TAATCAGCTCTCCTGGCTCCCTCCCGTAGTCTCCTGGGTGTGTTTGGCTTGGCCTTGGCATGGGCGCAG
GCCCAGTGACAAAGACTCCTCTGGGCCTGGGGTGCATCCTCCTCAGCCCCCAGGCCAGGTGAGGTCCAC
CGGCCCCTGGCAGCACAGCCCAGGGCCTGCATGGGGGCACCGGGCTCCATGCCTCTGGAGGCCTCTGGC
CCTCGGTGGCTGCACAGAAGGGCTCTTTCTCTCTGCTGAGCTGGGCCCAGCCCCTCCACGTGATTTCCA
GTGAGTGTAAATAATTTTAAATAACCTCTGGCCCTTGGAATAAAGTTCTGTTTTCTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000941.3
Synonyms CPR; CYPOR; P450R
Summary This gene encodes an endoplasmic reticulum membrane oxidoreductase that is essential for multiple metabolic processes, including reactions catalyzed by cytochrome P450 proteins for metabolism of steroid hormones, drugs and xenobiotics. The encoded protein has a flavin adenine dinucleotide (FAD)-binding domain and a flavodoxin-like domain which bind two cofactors, FAD and FMN, that allow it to donate electrons directly from NADPH to all microsomal P450 enzymes. Mutations in this gene cause a complex set of disorders, including apparent combined P450C17 and P450C21 deficiency, amenorrhea and disordered steroidogenesis, congenital adrenal hyperplasia and Antley-Bixler syndrome, that resemble those caused by defects in steroid metabolizing enzymes such as aromatase, 21-hydroxylase, and 17 alpha-hydroxylase. [provided by RefSeq, Aug 2020]
Locus ID 5447
MW 14.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Cytochrome P450 Reductase产品

Customer Reviews 
Loading...