IDH3B (NM_174856) Human 3' UTR Clone

CAT#: SC205019

3' UTR clone of isocitrate dehydrogenase 3 (NAD+) beta (IDH3B) nuclear gene encoding mitochondrial protein transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IDH3B (NM_174856) Human 3' UTR Clone
Vector pMirTarget
Synonyms FLJ11043; H-IDHB; MGC903; RP46
ACCN NM_174856
Insert Size 402 bp
Sequence Data
>SC205019 3’UTR clone of NM_174856
The sequence shown below is from the reference sequence of NM_174856. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCGGTCACCTGCAGACTAAAGGGAGCTAGAGCCCTTTATTTCTTCCAACCTTGCAAGGACCACACTCC
CCATACCCTTCAGTGCAGTGTACCAGGGAAGAGACCTTGTGCCTCTAAGCAGTGGACCATGGTCACCTT
GCTGGGTAGAGCCTAGGTTGTCCTTGGGCCGGCTTCCTTAGGGGACAGACTGTTGGGTGGTGATGGGGA
TTGTTAGGATGGAGCCCAGGCCACATGGATGATGATGATTCTCCCCCACAGGTTCGAACCTCTGACATG
GGTGGCTATGCTACTTGCCATGACTTCACTGAGGCTGTCATTGCTGCCTTGCCCCACCCATAGGCCCTG
TCCATACCCATGTAAGGTGTTCAATAAAGAACATGAACCAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_174856.1
Synonyms FLJ11043; H-IDHB; MGC903; RP46
Summary Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. NAD(+)-dependent isocitrate dehydrogenases catalyze the allosterically regulated rate-limiting step of the tricarboxylic acid cycle. Each isozyme is a heterotetramer that is composed of two alpha subunits, one beta subunit, and one gamma subunit. The protein encoded by this gene is the beta subunit of one isozyme of NAD(+)-dependent isocitrate dehydrogenase. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Sep 2016]
Locus ID 3420
MW 14.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...