EVA1 (MPZL2) (NM_144765) Human 3' UTR Clone

CAT#: SC204917

3' UTR clone of myelin protein zero-like 2 (MPZL2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name EVA1 (MPZL2) (NM_144765) Human 3' UTR Clone
Vector pMirTarget
Synonyms DFNB111; EVA; EVA1
ACCN NM_144765
Insert Size 369 bp
Sequence Data
>SC204917 3’UTR clone of NM_144765
The sequence shown below is from the reference sequence of NM_144765. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCTCTGTTTATTTAGAAGACACAGACTAACAATTTTAGATGGTAAGGTTCACAAATAGGTTGATTTCT
TTCTTCAGCTTTCTGACATGTCCAGCCCATCTCTAATGAGGACTCCCAGATCATCACTTTATGGCTGTT
AGGTGTTTCCCATATGAAATTAGAGGAGCTGGGTCAGGGAGACAAAAGTCTTCTATTAGTCTTATGGAT
AGCTCCTCCTTGAGTGTATTTTGTGCAAAAGATTAAGAAGCTGGACTCTACTGCCATTAAAGCTGAGAG
AATCCTAAGGTTATTTGTGGCTTCGGGGTTATATTTATTACTACTACTACTAATAAATATTCAACAAGT
AAATAAATCTTTTTTAAATCAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_144765.3
Synonyms DFNB111; EVA; EVA1
Summary Thymus development depends on a complex series of interactions between thymocytes and the stromal component of the organ. Epithelial V-like antigen (EVA) is expressed in thymus epithelium and strongly downregulated by thymocyte developmental progression. This gene is expressed in the thymus and in several epithelial structures early in embryogenesis. It is highly homologous to the myelin protein zero and, in thymus-derived epithelial cell lines, is poorly soluble in nonionic detergents, strongly suggesting an association to the cytoskeleton. Its capacity to mediate cell adhesion through a homophilic interaction and its selective regulation by T cell maturation might imply the participation of EVA in the earliest phases of thymus organogenesis. The protein bears a characteristic V-type domain and two potential N-glycosylation sites in the extracellular domain; a putative serine phosphorylation site for casein kinase 2 is also present in the cytoplasmic tail. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 10205
MW 13.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...