Prealbumin (TTR) (NM_000371) Human 3' UTR Clone

CAT#: SC204815

3' UTR clone of transthyretin (TTR) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Prealbumin (TTR) (NM_000371) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATTR; CTS; CTS1; HEL111; HsT2651; PALB; TBPA; TTN
ACCN NM_000371
Insert Size 176 bp
Sequence Data
>SC204815 3’UTR clone of NM_000371
The sequence shown below is from the reference sequence of NM_000371. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACGGCTGTCGTCACCAATCCCAAGGAATGAGGGACTTCTCCTCCAGTGGACCTGAAGGACGAGGGATGG
GATTTCATGTAACCAAGAGTATTCCATTTTTACTAAAGCAGTGTTTTCACCTCATATGCTATGTTAGAA
GTCCAGGCAGAGACAATAAAACATTCCTGTGAAAGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000371.4
Synonyms ATTR; CTS; CTS1; HEL111; HsT2651; PALB; TBPA; TTN
Summary This gene encodes one of the three prealbumins, which include alpha-1-antitrypsin, transthyretin and orosomucoid. The encoded protein, transthyretin, is a homo-tetrameric carrier protein, which transports thyroid hormones in the plasma and cerebrospinal fluid. It is also involved in the transport of retinol (vitamin A) in the plasma by associating with retinol-binding protein. The protein may also be involved in other intracellular processes including proteolysis, nerve regeneration, autophagy and glucose homeostasis. Mutations in this gene are associated with amyloid deposition, predominantly affecting peripheral nerves or the heart, while a small percentage of the gene mutations are non-amyloidogenic. The mutations are implicated in the etiology of several diseases, including amyloidotic polyneuropathy, euthyroid hyperthyroxinaemia, amyloidotic vitreous opacities, cardiomyopathy, oculoleptomeningeal amyloidosis, meningocerebrovascular amyloidosis and carpal tunnel syndrome. [provided by RefSeq, Aug 2017]
Locus ID 7276
MW 6.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...