26S proteasome non ATPase regulatory subunit 12 (PSMD12) (NM_002816) Human 3' UTR Clone

CAT#: SC204794

3' UTR clone of proteasome (prosome macropain) 26S subunit non-ATPase 12 (PSMD12) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name 26S proteasome non ATPase regulatory subunit 12 (PSMD12) (NM_002816) Human 3' UTR Clone
Vector pMirTarget
Synonyms p55; Rpn5; STISS
ACCN NM_002816
Insert Size 364 bp
Sequence Data
>SC204794 3' UTR clone of NM_002816
The sequence shown below is from the reference sequence of NM_002816. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CGCATCTCATAGCCAAAGAGGAGATGATACATAATCTACAATAAGGGTCTTAGTGCTTTAGAAAAAAGTT
AAAATTGGAAGTCATTAAAAAAAGACTGTTATAATGGTGTATATGTTGGGGTTTTTTTTCTAAGCTTCTT
TGTCTTAAATTTTAAAATAGTGAATATGTTTGAGACTCCCTTTGACCTTTCAGTTCCCCAAGTTCATTGT
TAACTTTGCATTTGCAATTGGTGCAAAAATACAGATTTCTGTCGTCTGAATACACAAAAAGTTGTGTCAT
AACTTACCCAGATATGTTTTTCTATCATTTGAAACCTTTTTAGCTACTGTTTGTTTTCATTCAACTAACA
AACATATTCCAATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002816.3
Synonyms p55; Rpn5; STISS
Summary The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a non-ATPase subunit of the 19S regulator. A pseudogene has been identified on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2015]
Locus ID 5718
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它26S proteasome non ATPase regulatory subunit 12产品

Customer Reviews 
Loading...