HNMT (NM_001024074) Human 3' UTR Clone

CAT#: SC204791

3' UTR clone of histamine N-methyltransferase (HNMT) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HNMT (NM_001024074) Human 3' UTR Clone
Vector pMirTarget
Synonyms HMT; HNMT-S1; HNMT-S2; MRT51
ACCN NM_001024074
Insert Size 346 bp
Sequence Data
>SC204791 3’UTR clone of NM_001024074
The sequence shown below is from the reference sequence of NM_001024074. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATAATAGGAAGATACCAGAATTGCTGTTAACAAATAAAATACTGGCCAGATGTGTTGGTTCACGCCTGT
AATCCTAGCACTTCGGGAGGCTGAGGCGGGAGGATTACTTGAGCCTAGGAGTTTGAGACCAGCCTGGGC
AACATAGCAAGATCCCATCTCTACAAAAAAGTGAAAAAGTTAGCTGAACAAGGCGGCATGCACATGCTA
CTCCAGACGCTGAAGTGGGAAGATCACTTAAGTCCGAGAGATCGAGGCTTCAGTGAGATATGGCTGAGA
CACTGCTCTCAGCCTGGATGACAGAGTGAGAACCTGTCTCAAACAAGAGAAAAAAATAAATCAAATGCTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001024074.3
Synonyms HMT; HNMT-S1; HNMT-S2; MRT51
Summary In mammals, histamine is metabolized by two major pathways: N(tau)-methylation via histamine N-methyltransferase and oxidative deamination via diamine oxidase. This gene encodes the first enzyme which is found in the cytosol and uses S-adenosyl-L-methionine as the methyl donor. In the mammalian brain, the neurotransmitter activity of histamine is controlled by N(tau)-methylation as diamine oxidase is not found in the central nervous system. A common genetic polymorphism affects the activity levels of this gene product in red blood cells. Multiple alternatively spliced transcript variants that encode different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 3176
MW 13.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...