Cytochrome P450 2C8 (CYP2C8) (NM_000770) Human 3' UTR Clone

CAT#: SC204785

3' UTR clone of cytochrome P450 family 2 subfamily C polypeptide 8 (CYP2C8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cytochrome P450 2C8 (CYP2C8) (NM_000770) Human 3' UTR Clone
Vector pMirTarget
Synonyms CPC8; CYP2C8DM; CYPIIC8; MP-12/MP-20
ACCN NM_000770
Insert Size 386 bp
Sequence Data
>SC204785 3’UTR clone of NM_000770
The sequence shown below is from the reference sequence of NM_000770. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCATACCAGATCTGCTTCATCCCTGTCTGAAGAATGCTAGCCCATCTGGCTGCCGATCTGCTATCACCT
GCAACTCTTTTTTTATCAAGGACATTCCCACTATTATGTCTTCTCTGACCTCTCATCAAATCTTCCCAT
TCACTCAATATCCCATAAGCATCCAAACTCCATTAAGGAGAGTTGTTCAGGTCACTGCACAAATATATC
TGCAATTATTCATACTCTGTAACACTTGTATTAATTGCTGCATATGCTAATACTTTTCTAATGCTGACT
TTTTAATATGTTATCACTGTAAAACACAGAAAAGTGATTAATGAATGATAATTTAGATCCATTTCTTTT
GTGAATGTGCTAAATAAAAAGTGTTATTAATTGCTGGTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000770.3
Synonyms CPC8; CYP2C8DM; CYPIIC8; MP-12/MP-20
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by phenobarbital. The enzyme is known to metabolize many xenobiotics, including the anticonvulsive drug mephenytoin, benzo(a)pyrene, 7-ethyoxycoumarin, and the anti-cancer drug taxol. This gene is located within a cluster of cytochrome P450 genes on chromosome 10q24. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Locus ID 1558
MW 14.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...