Signal Peptide Peptidase (HM13) (NM_178581) Human 3' UTR Clone

CAT#: SC204781

3' UTR clone of histocompatibility (minor) 13 (HM13) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Signal Peptide Peptidase (HM13) (NM_178581) Human 3' UTR Clone
Vector pMirTarget
Synonyms H13; IMP1; IMPAS; IMPAS-1; MSTP086; PSENL3; PSL3; SPP; SPPL1
ACCN NM_178581
Insert Size 354 bp
Sequence Data
>SC204781 3’UTR clone of NM_178581
The sequence shown below is from the reference sequence of NM_178581. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCGAAGGGGCTGGAGAAGAAAGAGAAATGATGCAGCTGGTGCCCGAGCCTCTCAGGGCCAGACCAGACA
GATGGGGGCTGGGCCCACACAGGCGTGCACCGGTAGAGGGCACAGGAGGCCAAGGGCAGCTCCAGGACA
GGGCAGGGGGCAGCAGGATACCTCCAGCCAGGCCTCTGTGGCCTCTGTTTCCTTCTCCCTTTCTTGGCC
CTCCTCTGCTCCTCCCCACACCCTGCAGGCAAAAGAAACCCCCAGCTTCCCCCCTCCCCGGGAGCCAGG
TGGGAAAAGTGGGTGTGATTTTTAGATTTTGTATTGTGGACTGATTTTGCCTCACATTAAAAACTCATC
CCATGGCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_178581.3
Synonyms H13; IMP1; IMPAS; IMPAS-1; MSTP086; PSENL3; PSL3; SPP; SPPL1
Summary The protein encoded by this gene, which localizes to the endoplasmic reticulum, catalyzes intramembrane proteolysis of some signal peptides after they have been cleaved from a preprotein. This activity is required to generate signal sequence-derived human lymphocyte antigen-E epitopes that are recognized by the immune system, and to process hepatitis C virus core protein. The encoded protein is an integral membrane protein with sequence motifs characteristic of the presenilin-type aspartic proteases. Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 81502
MW 12.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...