OA1 (GPR143) (NM_000273) Human 3' UTR Clone

CAT#: SC204667

3' UTR clone of G protein-coupled receptor 143 (GPR143) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name OA1 (GPR143) (NM_000273) Human 3' UTR Clone
Vector pMirTarget
Synonyms NYS6; OA1
ACCN NM_000273
Insert Size 344 bp
Sequence Data
>SC204667 3' UTR clone of NM_000273
The sequence shown below is from the reference sequence of NM_000273. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTGACCCTGCTCTCCCAACCCATGGAGACCTATGAAGGGGATGTGCTGGGGGTCCAGACCCCATATTCCT
CAGACTCAACAATTCTTGTTCTTTAGAACTGTGTTCTCACCTTCCCAACACTGCACTGCCGAAGTGTAGC
GGCCCCCAAACCTTGCTCTCATCACCAGCTAGAGCTTCTTCCCGAAGGGCCTTTAGGATAGGAGAAAGGG
TTCATGCACACACGTGTGAGAATGGAAGAGCCCCCTCCAGACCACTCTACAGCTGCTCTAGCCTTAGTTG
CCACTAGGAAGTTTTCTGAGGCTGGCTGTAAAGTAAGTGTAAGGTCCACATCCTTGGGGAAGTA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000273.2
Synonyms NYS6; OA1
Summary This gene encodes a protein that binds to heterotrimeric G proteins and is targeted to melanosomes in pigment cells. This protein is thought to be involved in intracellular signal transduction mechanisms. Mutations in this gene cause ocular albinism type 1, also referred to as Nettleship-Falls type ocular albinism, a severe visual disorder. A related pseudogene has been identified on chromosome Y. [provided by RefSeq, Dec 2009]
Locus ID 4935
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...