Proprotein convertase PC4 (PCSK4) (NM_017573) Human 3' UTR Clone

CAT#: SC204593

3' UTR clone of proprotein convertase subtilisin/kexin type 4 (PCSK4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Proprotein convertase PC4 (PCSK4) (NM_017573) Human 3' UTR Clone
Vector pMirTarget
Synonyms PC4; SPC5
ACCN NM_017573
Insert Size 361 bp
Sequence Data
>SC204593 3’UTR clone of NM_017573
The sequence shown below is from the reference sequence of NM_017573. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCCAGGTCTGGCTGCCAGCTGGAACCTGAAGTTGTCAGCTCAGAAAGCGACCTTGCCCCCGCCTGGGT
CCCTGACAGGCACTGCTGCCATGCTGCCTCCCCAGGCTGGCCCCAGAGGAGCGAGCACCAGCACCCGAC
GCCTGGCCTGCCAGGGATGGGCCCCGTGGAACCCCGAAGCCTGGCGGGAGAGAGAGAGAGAGAAGTCTC
CTCTGCATTTTGGGTTTGGGCGGGAGTGGGCTGGGGGGAGAGGCTGGAGCACCCCAAAAGCCAGGGGAA
AGTGGAGGGAGAGAAACGTGACACTGTCCGCCTCGGGCACCGCGTCCAACCTCAGAGTTTGCAAATAAA
GGTTGCTTAGAAGGTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_017573.5
Synonyms PC4; SPC5
Summary This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to subcellular compartments where a second autocatalytic even takes place and the catalytic activity is acquired. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. The protease is expressed only in the testis, placenta, and ovary. It plays a critical role in fertilization, fetoplacental growth, and embryonic development and processes multiple prohormones including pro-pituitary adenylate cyclase-activating protein and pro-insulin-like growth factor II. [provided by RefSeq, Jan 2014]
Locus ID 54760
MW 12.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

其它Proprotein convertase PC4产品

Customer Reviews 
Loading...