SSB (NM_003142) Human 3' UTR Clone

CAT#: SC204520

3' UTR clone of Sjogren syndrome antigen B (autoantigen La) (SSB) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SSB (NM_003142) Human 3' UTR Clone
Vector pMirTarget
Synonyms La; La/SSB; LARP3
ACCN NM_003142
Insert Size 338 bp
Sequence Data
>SC204520 3’UTR clone of NM_003142
The sequence shown below is from the reference sequence of NM_003142. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAAACAGAAAATGGTGCTGGAGACCAGTAGTTTAGTAAACCAATTTTTTATTCATTTTAAATAGGTTTT
AAACGACTTTTGTTTGCGGGGCTTTTAAAAGGAAAACCGAATTAGGTCCACTTCAATGTCCACCTGTGA
GAAAGGAAAAATTTTTTTGTTGTTTAACTTGTCTTTTTGTTATGCAAATGAGATTTCTTTGAATGTATT
GTTCTGTTTGTGTTATTTCAGATGATTCAAATATCAAAAGGAAGATTCTTCCATTAAATTGCCTTTGTA
ATATGAGAATGTATTAGTACAAACTAACTAATAAAATATATACTATATGAAAAGAGCAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003142.5
Synonyms La; La/SSB; LARP3
Summary The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
Locus ID 6741
MW 13.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...