ATP2A1 (NM_173201) Human 3' UTR Clone

CAT#: SC204491

3' UTR clone of ATPase Ca++ transporting cardiac muscle fast twitch 1 (ATP2A1) transcript variant a for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ATP2A1 (NM_173201) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP2A; SERCA1
ACCN NM_173201
Insert Size 291 bp
Sequence Data
>SC204491 3’UTR clone of NM_173201
The sequence shown below is from the reference sequence of NM_173201. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGATCCAGAAGATGAAAGAAGGAAGTGAGCATCCTTTTGCTCTGTCCTCCCCACCCCGATAGTGACA
CATCTTCAGGCAGAGCTGTGGCACAGACCCCCGTCCTGTCCCCCACACCCGTGTCATGTGTCTGTTTAT
AAACATGTCCCCTTCCCTTTCCTTCCCCCTCGGCCACCCGCCTCCCTCTCAACCTTGTAAATTCCCCTT
CCCAACCCCGAGGGGCTTGCAGGGACAAGGCGACCGACTGCGCTGAGCTGCTTATTTATTGAAAATAAA
CGACGGAAAAGTCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_173201.5
Synonyms ATP2A; SERCA1
Summary This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
Locus ID 487
MW 10.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...