IGFBP2 (NM_000597) Human 3' UTR Clone

CAT#: SC204420

3' UTR clone of insulin-like growth factor binding protein 2 36kDa (IGFBP2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IGFBP2 (NM_000597) Human 3' UTR Clone
Vector pMirTarget
Synonyms IBP2; IGF-BP53
ACCN NM_000597
Insert Size 362 bp
Sequence Data
>SC204420 3’UTR clone of NM_000597
The sequence shown below is from the reference sequence of NM_000597. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCGGGGTGCACACCCAGCGGATGCAGTAGACCGCAGCCAGCCGGTGCCTGGCGCCCCTGCCCCCCGCC
CCTCTCCAAACACCGGCAGAAAACGGAGAGTGCTTGGGTGGTGGGTGCTGGAGGATTTTCCAGTTCTGA
CACACGTATTTATATTTGGAAAGAGACCAGCACCGAGCTCGGCACCTCCCCGGCCTCTCTCTTCCCAGC
TGCAGATGCCACACCTGCTCCTTCTTGCTTTCCCCGGGGGAGGAAGGGGGTTGTGGTCGGGGAGCTGGG
GTACAGGTTTGGGGAGGGGGAAGAGAAATTTTTATTTTTGAACCCCTGTGTCCCTTTTGCATAAGATTA
AAGGAAGGAAAAGTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000597.3
Synonyms IBP2; IGF-BP53
Summary The protein encoded by this gene is one of six similar proteins that bind insulin-like growth factors I and II (IGF-I and IGF-II). The encoded protein can be secreted into the bloodstream, where it binds IGF-I and IGF-II with high affinity, or it can remain intracellular, interacting with many different ligands. High expression levels of this protein promote the growth of several types of tumors and may be predictive of the chances of recovery of the patient. Several transcript variants, one encoding a secreted isoform and the others encoding nonsecreted isoforms, have been found for this gene. [provided by RefSeq, Sep 2015]
Locus ID 3485
MW 13.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...