ATP6V1B1 (NM_001692) Human 3' UTR Clone

CAT#: SC204335

3' UTR clone of ATPase H+ transporting lysosomal 56/58kDa V1 subunit B1 (ATP6V1B1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ATP6V1B1 (NM_001692) Human 3' UTR Clone
Vector pMirTarget
Synonyms ATP6B1; DRTA2; RTA1B; VATB; VMA2; VPP3
ACCN NM_001692
Insert Size 340 bp
Sequence Data
>SC204335 3’UTR clone of NM_001692
The sequence shown below is from the reference sequence of NM_001692. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGGACCTCGCGCCTGACACTGCGCTCTAGCCCCGCGCGCCGTGGCACCCCAACACCGGCAGGGAACCT
ACCCTCGGCTCCCGGGTCTCCCCTCCCTCGCCACCCCAACCAGCGGCTTCTGCGCCGCCCTCCGCCCTC
CGCTGGCTCCGAGGTGGTGGGGGCGCCGCACGCTCCATCCCTTTCCCTCGCTCGATTCCTTTTCCCGCG
CTCCATGCCTCCCCCTCGACTCCCGGTGCTGCGGAAGAACTGAAGGTTGCGATGCCTTACTCTGACGGG
AGCATCTGTATTTTTATGTTAAAAGCCCACAAAATAAAAATAAAAAGTAACTGAGATGAATTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001692.4
Synonyms ATP6B1; DRTA2; RTA1B; VATB; VMA2; VPP3
Summary This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c'', and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This encoded protein is one of two V1 domain B subunit isoforms and is found in the kidney. Mutations in this gene cause distal renal tubular acidosis associated with sensorineural deafness. [provided by RefSeq, Jul 2008]
Locus ID 525
MW 12
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...