ITGB3BP (NM_014288) Human 3' UTR Clone

CAT#: SC204332

3' UTR clone of integrin beta 3 binding protein (beta3-endonexin) (ITGB3BP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ITGB3BP (NM_014288) Human 3' UTR Clone
Vector pMirTarget
Synonyms CENP-R; CENPR; HSU37139; NRIF3; TAP20
ACCN NM_014288
Insert Size 365 bp
Sequence Data
>SC204332 3’UTR clone of NM_014288
The sequence shown below is from the reference sequence of NM_014288. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TATGAATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCAACTT
CTGCATCTGCCTGATCATATTTAAAGGAACAGAGAAATATTTGTAATTAATCTGCCCAGTAAATACCAG
CTCGTAGCAGTTGGCAGGTGCATGTCTAGATAAAATTTCTTGCAGCTAATTTAAACTTTCTACACGCAC
CAGTAGATAATCTCAATGTAAATAATACATTTCTTCTTGGCTCTTTAATGTAAGCCAACATGGAGAGGA
AGATCTTGACTTATATTCTGTACCACATACACTTCTGTGGACTTTTAGCATTTGTGGGTAGACTTAATA
AAGCATGTATAAAAGTGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014288.5
Synonyms CENP-R; CENPR; HSU37139; NRIF3; TAP20
Summary This gene encodes a transcriptional coregulator that binds to and enhances the activity of members of the nuclear receptor families, thyroid hormone receptors and retinoid X receptors. This protein also acts as a corepressor of NF-kappaB-dependent signaling. This protein induces apoptosis in breast cancer cells through a caspase 2-mediated signaling pathway. This protein is also a component of the centromere-specific histone H3 variant nucleosome associated complex (CENP-NAC) and may be involved in mitotic progression by recruiting the histone H3 variant CENP-A to the centromere. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
Locus ID 23421
MW 14.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...