BCKDHB (NM_000056) Human 3' UTR Clone

CAT#: SC204313

3' UTR clone of branched chain keto acid dehydrogenase E1 beta polypeptide (BCKDHB) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name BCKDHB (NM_000056) Human 3' UTR Clone
Vector pMirTarget
Synonyms BCKDE1B; BCKDH E1-beta; E1B
ACCN NM_000056
Insert Size 334 bp
Sequence Data
>SC204313 3’UTR clone of NM_000056
The sequence shown below is from the reference sequence of NM_000056. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GATGCCCTTCGAAAAATGATCAACTATTGACCATATAGAAAAGCTGGAAGATTATGACTAGATATGGAA
ATATTTTTTCTGAATTTTTTTTTATATTTCCTCCGACTTACCTCTTTTTGAAAAGAGAGTTTTTATTAA
GTGAACCATCACGATATTGGCTGAAAAGTTCTACATTCTATTATTGTATTGTAACACACATGTATTGAT
GATTTTCATTAAGAGTTTCAGATTAACTTTGAAAAATATTCCACATGGTAATCTTATAAATTCTGTTTA
ATTACATCTGTAAATATTATGTGTGTGATAGTATTCAATAAAGTAAAATCAAATTGTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000056.5
Synonyms BCKDE1B; BCKDH E1-beta; E1B
Summary This gene encodes the E1 beta subunit of branched-chain keto acid dehydrogenase, which is a multienzyme complex associated with the inner membrane of mitochondria. This enzyme complex functions in the catabolism of branched-chain amino acids. Mutations in this gene have been associated with maple syrup urine disease (MSUD), type 1B, a disease characterized by a maple syrup odor to the urine in addition to mental and physical retardation and feeding problems. Alternative splicing at this locus results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Locus ID 594
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...