Cip4 (TRIP10) (NM_004240) Human 3' UTR Clone

CAT#: SC204304

3' UTR clone of thyroid hormone receptor interactor 10 (TRIP10) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Cip4 (TRIP10) (NM_004240) Human 3' UTR Clone
Vector pMirTarget
Synonyms CIP4; HSTP; STOT; STP; TRIP-10
ACCN NM_004240
Insert Size 349 bp
Sequence Data
>SC204304 3’UTR clone of NM_004240
The sequence shown below is from the reference sequence of NM_004240. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCTCCTACCTCCGAGTCACGCTCAATTGAACCCTGCCAGAGACGGGAAGAGGGGGGCTGTCGGCTGCT
GCTTCTGGGCCACGGGGAGCCCCAGGACCTATGCACTTTATTTCTGACCCCGTGGCTTCGGCTGAGACC
TGTGTAACCTGCTGCCCCCTCCACCCCCAACCCAGTCCTACCTGTCACACCGGACGGACCCGCTGTGCC
TTCTACCATCGTTCCACCATTGATGTACATACTCATGTTTTACATCTTTTCTTTCTGCCGCTCGGCTCC
GGCCATTTTGTTTTATACAAAAATGGGAAAAAAAAAAAAGAAATTATATAAAGTTCCTAGAGTCGGTGT
CTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004240.4
Synonyms CIP4; HSTP; STOT; STP; TRIP-10
Summary Required for translocation of GLUT4 to the plasma membrane in response to insulin signaling (By similarity). Required to coordinate membrane tubulation with reorganization of the actin cytoskeleton during endocytosis. Binds to lipids such as phosphatidylinositol 4,5-bisphosphate and phosphatidylserine and promotes membrane invagination and the formation of tubules. Also promotes CDC42-induced actin polymerization by recruiting WASL/N-WASP which in turn activates the Arp2/3 complex. Actin polymerization may promote the fission of membrane tubules to form endocytic vesicles. Required for the formation of podosomes, actin-rich adhesion structures specific to monocyte-derived cells. May be required for the lysosomal retention of FASLG/FASL.[UniProtKB/Swiss-Prot Function]
Locus ID 9322
MW 12.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...