TEX264 (NM_015926) Human 3' UTR Clone

CAT#: SC204281

3' UTR clone of testis expressed 264 (TEX264) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TEX264 (NM_015926) Human 3' UTR Clone
Vector pMirTarget
Synonyms ZSIG11
ACCN NM_015926
Insert Size 337 bp
Sequence Data
>SC204281 3’UTR clone of NM_015926
The sequence shown below is from the reference sequence of NM_015926. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCACTGCCCCTGAGAAGGGCAAGGAGTAACCCATGGCCTGCACCCTCCTGCAGTGCAGTTGCTGAGGA
ACTGAGCAGACTCTCCAGCAGACTCTCCAGCCCTCTTCCTCCTTCCTCTGGGGGAGGAGGGGTTCCTGA
GGGACCTGACTTCCCCTGCTCCAGGCCTCTTGCTAAGCCTTCTCCTCACTGCCCTTTAGGCTCCCAGGG
CCAGAGGAGCCAGGGACTATTTTCTGCACCAGCCCCCAGGGCTGCCACCCCTGTTGTGTCTTTTTTTCA
GACTCACAGTGGAGCTTCCAGGACCCAGAATAAAGCCAATGATTTACTTGTTTCACCTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015926.6
Synonyms ZSIG11
Summary Major reticulophagy (also called ER-phagy) receptor that acts independently of other candidate reticulophagy receptors to remodel subdomains of the endoplasmic reticulum into autophagosomes upon nutrient stress, which then fuse with lysosomes for endoplasmic reticulum turnover (PubMed:31006538, PubMed:31006537). The ATG8-containing isolation membrane (IM) cradles a tubular segment of TEX264-positive ER near a three-way junction, allowing the formation of a synapse of 2 juxtaposed membranes with trans interaction between the TEX264 and ATG8 proteins (PubMed:31006537). Expansion of the IM would extend the capture of ER, possibly through a 'zipper-like' process involving continued trans TEX264-ATG8 interactions, until poorly understood mechanisms lead to the fission of relevant membranes and, ultimately, autophagosomal membrane closure (PubMed:31006537).[UniProtKB/Swiss-Prot Function]
Locus ID 51368
MW 12.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...