MPST (NM_001013436) Human 3' UTR Clone

CAT#: SC204222

3' UTR clone of mercaptopyruvate sulfurtransferase (MPST) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MPST (NM_001013436) Human 3' UTR Clone
Vector pMirTarget
Synonyms MST; TST2; TUM1
ACCN NM_001013436
Insert Size 331 bp
Sequence Data
>SC204222 3’UTR clone of NM_001013436
The sequence shown below is from the reference sequence of NM_001013436. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCTCAGAGGGCCGGGGGAAGACCCACTGAAGCTGGGCAGGACACAGGCGAGCTCAGGTGATGCCGGCC
ACCAGCAATGCCTGGCCTGGTAGCTCCGCTTCTGCTTTCACCAAGAGAGTGTTTCTTCACTCAACTCAG
GTGGCATTTGGGGTGACATCTCAAAGGCCAGGAATTCCGTTGACTTGTTGGCTGCCAGTAGGGGCGGGA
GGAAAGGCGGAGGCGAGCCCTGGAGGAGGGAGGCCACAACTCCGAGCTGCCCACCTGGTGCTGAGCTGG
GGCCCCGCCTCCTTTCTGTTTTATTTTTGAGGAAATAAAATAACCAAGTGCTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001013436.4
Synonyms MST; TST2; TUM1
Summary This protein encoded by this gene catalyzes the transfer of a sulfur ion from 3-mercaptopyruvate to cyanide or other thiol compounds. It may be involved in cysteine degradation and cyanide detoxification. There is confusion in literature between this protein (mercaptopyruvate sulfurtransferase, MPST), which appears to be cytoplasmic, and thiosulfate sulfurtransferase (rhodanese, TST, GeneID:7263), which is a mitochondrial protein. Deficiency in MPST activity has been implicated in a rare inheritable disorder known as mercaptolactate-cysteine disulfiduria (MCDU). Alternatively spliced transcript variants encoding same or different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Locus ID 4357
MW 11.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...