PSMB9 (NM_002800) Human 3' UTR Clone

CAT#: SC204194

3' UTR clone of proteasome (prosome macropain) subunit beta type 9 (large multifunctional peptidase 2) (PSMB9) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PSMB9 (NM_002800) Human 3' UTR Clone
Vector pMirTarget
Synonyms beta1i; LMP2; PRAAS3; PSMB6i; RING12
ACCN NM_002800
Insert Size 349 bp
Sequence Data
>SC204194 3’UTR clone of NM_002800
The sequence shown below is from the reference sequence of NM_002800. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AATGAACTGCCAAAATTCTATGATGAGTGAACCTTCCCCAGACTTCTCTTTCTTATTTTGTAATAAACT
CTCTAGGGCCAAAACCTGGTATGGTCATTGGGAAATGAGTGCTCAGGGAGATGGAGCTTAGGGGAGGTG
GGTGCTTCCCTCCTAGATGTCAGCATACACTCTTTCTTCTTTTGTCCCAGGTCTAAAACATCTTTCCTA
GAGAAAACAAAAGGGACTAAACTAGAAATATAAAGAGCCCTATACATGACAGGTGATCACGTACTGAAT
GATTTTGAAGTAGTACAAACAATAAAAATTCTCATTCCGCATCATCATGCGGTCCATGATGATGAGGCC
GCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002800.5
Synonyms beta1i; LMP2; PRAAS3; PSMB6i; RING12
Summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is located in the class II region of the MHC (major histocompatibility complex). Expression of this gene is induced by gamma interferon and this gene product replaces catalytic subunit 1 (proteasome beta 6 subunit) in the immunoproteasome. Proteolytic processing is required to generate a mature subunit. [provided by RefSeq, Mar 2010]
Locus ID 5698
MW 13.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...