RON (MST1R) (NM_002447) Human 3' UTR Clone

CAT#: SC204187

3' UTR clone of macrophage stimulating 1 receptor (c-met-related tyrosine kinase) (MST1R) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RON (MST1R) (NM_002447) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD136; CDw136; NPCA3; PTK8; RON; SEA
ACCN NM_002447
Insert Size 335 bp
Sequence Data
>SC204187 3’UTR clone of NM_002447
The sequence shown below is from the reference sequence of NM_002447. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCACTCTCAGAGCCTCCTCGGCCCACTTGACTTAGTTCTTGGGCTGGACCTGCTTAGCTGCCTTGAGCT
AACCCCAAGCTGCCTCTGGGCCATGCCAGGCCAGAGGGCAGTGGCCCTCCACCTTGTTCCTGCCCTTTA
ACTTTCAGAGGCAATAGGTAAATGGGGCCCATTAGGTCCCTCACTCCACAGAGTGAGCCAGTGAGGGCA
GTCCTGCAACATGTATTTATGGAGTGCCTGCTGTGGACCCTGTCTTCTGGGCACAGTGGACTCAGCAGT
GACCACACCAACACTGACCCTTGAACCAATAAAGGAACAAATGACTATTAAAGCACAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002447.4
Synonyms CD136; CDw136; NPCA3; PTK8; RON; SEA
Summary This gene encodes a cell surface receptor for macrophage-stimulating protein (MSP) with tyrosine kinase activity. The mature form of this protein is a heterodimer of disulfide-linked alpha and beta subunits, generated by proteolytic cleavage of a single-chain precursor. The beta subunit undergoes tyrosine phosphorylation upon stimulation by MSP. This protein is expressed on the ciliated epithelia of the mucociliary transport apparatus of the lung, and together with MSP, thought to be involved in host defense. Alternative splicing generates multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
Locus ID 4486
MW 11.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...