Apg3 (ATG3) (NM_022488) Human 3' UTR Clone

CAT#: SC204173

3' UTR clone of ATG3 autophagy related 3 homolog (S. cerevisiae) (ATG3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Apg3 (ATG3) (NM_022488) Human 3' UTR Clone
Vector pMirTarget
Synonyms APG3; APG3-LIKE; APG3L; PC3-96
ACCN NM_022488
Insert Size 191 bp
Sequence Data
>SC204173 3' UTR clone of NM_022488
The sequence shown below is from the reference sequence of NM_022488. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACTACACAAGACACTTCACAATGTAATGAAGAGAGCATAAAATCTATCCTAATTATTGGTTCTGATTTT
TAAAGAATTAACCCATAGATGTGACCATTGACCATATTCATCAATATATACAGTTTCTCTAATAAGGGAC
TTATATGTTTATGCATTAAATAAAAATATGTTCCACTACCAGCCTTACTTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022488.3
Synonyms APG3; APG3-LIKE; APG3L; PC3-96
Summary This gene encodes a ubiquitin-like-conjugating enzyme and is a component of ubiquitination-like systems involved in autophagy, the process of degradation, turnover and recycling of cytoplasmic constituents in eukaryotic cells. This protein is known to play a role in regulation of autophagy during cell death. A pseudogene of this gene is located on chromosome 20. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Locus ID 64422
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...