GM CSF (CSF2) (NM_000758) Human 3' UTR Clone

CAT#: SC204127

3' UTR clone of colony stimulating factor 2 (granulocyte-macrophage) (CSF2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GM CSF (CSF2) (NM_000758) Human 3' UTR Clone
Vector pMirTarget
Synonyms CSF; GMCSF
ACCN NM_000758
Insert Size 348 bp
Sequence Data
>SC204127 3’UTR clone of NM_000758
The sequence shown below is from the reference sequence of NM_000758. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTTGACTGCTGGGAGCCAGTCCAGGAGTGAGACCGGCCAGATGAGGCTGGCCAAGCCGGGGAGCTGCTC
TCTCATGAAACAAGAGCTAGAAACTCAGGATGGTCATCTTGGAGGGACCAAGGGGTGGGCCACAGCCAT
GGTGGGAGTGGCCTGGACCTGCCCTGGGCCACACTGACCCTGATACAGGCATGGCAGAAGAATGGGAAT
ATTTTATACTGACAGAAATCAGTAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTAT
TTAAGTTCATATTCCATATTTATTCAAGATGTTTTACCGTAATAATTATTATTAAAAATATGCTTCTAC
TTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000758.4
Synonyms CSF; GMCSF
Summary The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of granulocytes and macrophages. The active form of the protein is found extracellularly as a homodimer. This gene has been localized to a cluster of related genes at chromosome region 5q31, which is known to be associated with interstitial deletions in the 5q- syndrome and acute myelogenous leukemia. Other genes in the cluster include those encoding interleukins 4, 5, and 13. This gene plays a role in promoting tissue inflammation. Elevated levels of cytokines, including the one produced by this gene, have been detected in SARS-CoV-2 infected patients that develop acute respiratory distress syndrome. Mice deficient in this gene or its receptor develop pulmonary alveolar proteinosis. [provided by RefSeq, Aug 2020]
Locus ID 1437
MW 13.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...