CDK7 (NM_001799) Human 3' UTR Clone

CAT#: SC204099

3' UTR clone of cyclin-dependent kinase 7 (CDK7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CDK7 (NM_001799) Human 3' UTR Clone
Vector pMirTarget
Synonyms CAK; CAK1; CDKN7; HCAK; MO15; p39MO15; STK1
ACCN NM_001799
Insert Size 325 bp
Sequence Data
>SC204099 3’UTR clone of NM_001799
The sequence shown below is from the reference sequence of NM_001799. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAGGATTGCCCAAGAAACTAATTTTTTAAAGAGAACACTGGACAACATTTTACTACTGAGGGAAATAG
CCAAAAAGGCAAATAATGGAAAAATAGTAAACATTAAGTAAATGCTGTAGAAGTGAGTTTGTAAATATT
CTACACATGTAAAATATGTAAAACTATGGGTTATTTTTATTAAATGTATTTTAAAATAAAAATTTAATT
CTGGTTTTTCTGATTAGAGTGCAAAAGTGAGAAAAGTTCAATACTCTTGAAATGTAGAATTGAAAATGC
ATTAGGGAAAACTTAATAAAAATTATTACCAGTTATTTGGAAGATCTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001799.4
Synonyms CAK; CAK1; CDKN7; HCAK; MO15; p39MO15; STK1
Summary The protein encoded by this gene is a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This protein forms a trimeric complex with cyclin H and MAT1, which functions as a Cdk-activating kinase (CAK). It is an essential component of the transcription factor TFIIH, that is involved in transcription initiation and DNA repair. This protein is thought to serve as a direct link between the regulation of transcription and the cell cycle. [provided by RefSeq, Jul 2008]
Locus ID 1022
MW 13
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...