ART3 (NM_001130017) Human 3' UTR Clone

CAT#: SC204037

3' UTR clone of ADP-ribosyltransferase 3 (ART3) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ART3 (NM_001130017) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARTC3
ACCN NM_001130017
Insert Size 297 bp
Sequence Data
>SC204037 3’UTR clone of NM_001130017
The sequence shown below is from the reference sequence of NM_001130017. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCTGCTATAAATCTCTTTGTTGCTCTGTAGTTTGATGCATTGTTTATCTTTCTTATTCTTTACTTGAAA
TAACTATAGGGATCCACAGGAGATCAAAAGGAATGATGTATTTTTTACGTGTTGGCCAAAGTCACTGGA
TAAAATGAGAATTGTATATTTGTTATTCATTTTGCAAATTCAGAAAGTTGGTCCAGATATATGTCACAG
AACTTTTCACTTGTATACTACTCTTACAATGGAAAAAAATCCCGAAAACTGTATACTTCTGATTAAATT
CAATAAAAGATTTTGATTAGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130017.3
Synonyms ARTC3
Summary This gene encodes an arginine-specific ADP-ribosyltransferase. The encoded protein catalyzes a reversible reaction which modifies proteins by the addition or removal of ADP-ribose to an arginine residue to regulate the function of the modified protein. An ADP-ribosyltransferase pseudogene is located on chromosome 11. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Locus ID 419
MW 11.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...